Informations

Outil bioinformatique pour « l'alignement par paires » de séquences complémentaires ?

Outil bioinformatique pour « l'alignement par paires » de séquences complémentaires ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Je travaille actuellement sur une liaison de ribozyme, et je recherche un outil qui analysera essentiellement les régions du degré de complémentarité dans deux séquences afin d'extrapoler l'efficacité de la liaison. Après réflexion, je cherche essentiellement "l'opposé" de BLAST, en ce sens que BLAST recherche des régions de similarité en séquences dans le même orientation, alors que je recherche des régions de complémentarité en séquence dans le contraire orientation.

Un tel outil existe-t-il ?

MODIFIER 1

Pour clarifier, je recherche un outil capable de détecter les régions de complémentarité les plus optimales dans deux séquences lorsque les deux sont alignées en tant que telles :

5' TCGAAUAACTCGTCUGAUGAGUCGCUGAAAUGCGACGAAACCGTTAACGGA 3'

3' GTTTTACGCAAAGCAGCGTAAAGTCGCTGAGTAGTCACTTTAATGAC 5'


Je ne suis pas sûr que ce soit ce dont vous avez besoin car les séquences que vous avez publiées ne sont pas réellement complémentaires pour autant que je sache. Cependant, disculper est l'un des outils les plus puissants et peut également le faire. En utilisant ces séquences comme exemples :

>requête TAGCTTATTGATGGGAGGAGAGTCCGTGCACATGACAGACCTTGGCTGTCCCAGACTGCAGGAAGCCCAGG
>cible CCTGGGCTTCCTGCAGTCTGGGACAGCCAAGTCTGTTATGTGCACGTACTCTCCTCCCCTCAATAAGCTA

Et cette commande (doit être exécutée sur un système *nix) :

exonérer -m coding2coding -q qq.fa -t test.fa -s 0

J'obtiens cette sortie :

Alignement C4 : ------------ Requête : requête [revcomp] Cible : modèle cible : genome2genome Score brut : 312 Plage de la requête : 71 -> 0 Plage cible : 0 -> 70 71 : CCA : 6 CCTGGGCTTCCTGCAGTCTGGGACAGCCAAGGTCTGTCATGTGCACGGACTCTCCTCProTCAATA ||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||+|||||| CCTGGGCTTCCTGCAGTCTGGGACAGCCAA-GTCTGTTATGTGCACGTACTCTCCTCProTCAATA 1 : CCC : 65 5 : AGCTA : 1 ||||| 66 : AGCTA : 70 vulgaire : requête 71 0 - cible 0 70 + 312 M 30 30 G 1 0 M 26 26 C 3 3 M 11 11 C4 Alignement : ------------ Requête : requête cible : cible [revcomp] Modèle : genome2genome Score brut : 309 Plage de requête : 0 -> 71 Plage cible : 70 -> 0 1 : GTC : 66 TAGCTTATTGATGGGAGGAGAValCGTGCACATGACAGACCTTGGCTGTCCCAGACTGCAGGAAGC |||||||||| |||||||||||+||||||||| ||||| |||||||||||||||||||||||||| TAGCTTATTGAGGGGAGGAGAValCGTGCACATAACAGA-CTTGGCTGTCCCAGACTGCAGGAAGC 70 : GTA : 6 67 : CCAGG : 71 ||||| 5 : CCAGG : 1 vulgaire : requête 0 71 + cible 70 0 - 309 M 21 21 C 3 3 M 15 15 G 1 0 M 31 31

Fondamentalement, cela vous donne deux alignements, l'un lisant la cible 3->5 et la requête 5->3 et l'autre dans l'autre sens.

Alternativement, vous pouvez effectuer une recherche blast traduite, tBLASTx qui traduira à la fois la séquence cible et la séquence de requête et devrait donc trouver des régions complémentaires.


Vous pouvez essayer d'utiliser un outil pour estimer les affinités de liaison des deux séquences, c'est-à-dire OligoCalc

http://www.basic.northwestern.edu/biotools/OligoCalc.html


Exécutez simplement l'explosion avec seulement lePlus moinsalignements. Voir cet article dans biostar; il est similaire à ce qui vous intéresse. Ceci est pour la version autonome. Je ne sais pas comment le faire dans l'explosion en ligne. Si vous n'avez que deux séquences, vous pouvez utiliser UNAfold pour vérifier la complémentarité.