Informations

Comment purifier l'ARN après électrophorèse sur gel pour éliminer l'acrylamide résiduel ?

Comment purifier l'ARN après électrophorèse sur gel pour éliminer l'acrylamide résiduel ?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

J'utilise parfois l'électrophorèse sur gel dénaturant à l'échelle préparative pour purifier l'ARN produit par transcription in vitro. Le problème majeur avec ceci est que l'échantillon après extraction du gel contient encore des quantités importantes d'acrylamide, ou d'oligomères/polymères d'acrylamide.

L'échange de tampon à l'aide de Vivaspins ne l'élimine pas de manière fiable, la précipitation de l'ARN ne fait également que réduire la quantité, mais ne peut pas éliminer complètement l'acrylamide.

Dans certains cas, l'acrylamide n'interfère pas beaucoup avec les expériences ultérieures, mais certaines expériences ne fonctionneront pas avec l'acrylamide dans l'échantillon.

Quelles sont les options pour purifier l'ARN après électrophorèse sur gel qui élimineraient de manière fiable l'acrylamide de l'échantillon ? De préférence, ils doivent être simples et rapides, et non quelque chose comme une analyse FPLC/HPLC complète.


Si vous ne voulez pas d'acrylamide dans votre préparation, ne l'utilisez pas, car vous aurez toujours des résidus dans la solution. Et vous ne vous en débarrasserez pas complètement, car il coprécipitait au moins en partie avec les acides nucléiques (il est utilisé comme agent de coprécipitation à cette fin).

Je pense que la meilleure solution est d'utiliser la chromatographie, soit par exclusion de taille, soit sur des résines chargées. Voir ces deux documents pour plus d'informations :


L'agarose peut toujours être refondu pour être réutilisé. C'est aussi une excellente économie de coûts. Cependant, comme pour toute autre chose, il y a un moment où c'est avantageux et un moment où ça ne l'est pas.

Chaque fois que vous utilisez simplement des gels de routine ou que vous faites une démonstration, la réutilisation de votre gel d'agarose est une excellente option. Mais quand il s'agit du côté le plus fin de la recherche : confirmation des résultats, publication, clonage, séquençage, extraction, Southern blot, etc., nous vous recommandons d'utiliser un gel frais.

Sachez qu'à chaque fois qu'un gel est réutilisé, le bruit de fond commence à augmenter.

Soyez prudent lors de la refonte de l'agarose à bas point de fusion. La réutilisation de l'agarose à bas point de fusion peut influencer les concentrations car de l'eau est perdue pendant le processus de fusion.

En plus de la refusion, certains chercheurs retirent les bandes du gel et réutilisent le gel sans refondre. Avec le temps, cependant, le gel perdra de sa conductivité.


Méthodes

Dessaler

Chaque oligonucléotide est dessalé gratuitement.

Le dessalage élimine les impuretés de petites molécules, par ex. l'acrylonitrile résultant de la déprotection du squelette phosphodiester, qui sont des sous-produits résiduels du clivage et de la déprotection. Pour de nombreuses techniques/applications, y compris la PCR, le dessalage est acceptable pour les oligonucléotides ≤35 bases car l'abondance écrasante de séquences complètes l'emporte sur toute contribution des plus courts (en savoir plus sur le calcul du rendement). Les oligonucléotides >35 bases peuvent nécessiter une purification supplémentaire, telle qu'une cartouche à phase inverse (cartouche).

Aucun niveau de pureté garanti n'est fourni avec la purification par dessalage uniquement, car le processus n'élimine pas les shortmers.

Cartouche

La séparation sur une cartouche à phase inversée offre le prochain niveau de pureté (Figure 1). La base de la séparation est la différence d'hydrophobie entre la séquence complète (a un groupe 5'-DMT hydrophobe) et les plus courts (n'ont pas de groupes 5'-DMT). Alors que la séquence complète est conservée sur la colonne, les plus courts sont lavés. Après avoir clivé le 5'-DMT sur la cartouche, la séquence complète attendue est éluée et récupérée. De plus, les oligonucléotides modifiés avec certains colorants à l'extrémité 5', par ex. La cyanine ou WellRED sont compatibles avec la purification par cartouche en raison de l'hydrophobie accrue conférée par la partie colorante.

À mesure que la longueur des oligonucléotides augmente, la proportion de shortmers contenant un groupe 5'-DMT (le produit généré par des séquences non coiffées) a tendance à augmenter. Ces séquences indésirables ne seront pas éliminées par purification sur cartouche et, par conséquent, pour les oligonucléotides plus longs, la chromatographie liquide haute performance (HPLC) ou l'électrophorèse sur gel de polyacrylamide (PAGE) est recommandée.

Aucun niveau de pureté garanti n'est fourni avec la purification par cartouche. Cependant, de nombreuses années d'expérience ont révélé que 65 à 80 % de séquences complètes (via HPLC analytique) sont courantes.

RP-HPLC

La chromatographie liquide haute performance en phase inverse (RP-HPLC) fonctionne sur le même principe qu'une cartouche en phase inverse (Figure 1). Cependant, la résolution plus élevée permet des niveaux de pureté plus élevés. La RP-HPLC est une méthode de purification efficace pour les oligonucléotides contenant des colorants, car leur hydrophobie intrinsèque permet une excellente séparation de la séquence souhaitée de celles manquant le colorant, des shortmers et des shortmers avec des délétions. De plus, la RP-HPLC est la méthode de choix pour la synthèse à grande échelle en raison de la capacité et des propriétés de résolution de la colonne. Cependant, la résolution basée sur l'hydrophobie diminue avec la longueur de l'oligonucléotide. Par conséquent, la RP-HPLC n'est généralement pas recommandée pour purifier les oligonucléotides et gt50 bases. Bien que des oligonucléotides plus longs (jusqu'à 80 bases, dans certains cas plus longs) puissent être purifiés à l'aide de cette méthode, la pureté et les rendements peuvent être défavorablement affectés.

La RP-HPLC standard atteint généralement une pureté supérieure à 85 % de la séquence pleine longueur (via une HPLC analytique). Des niveaux de pureté plus élevés peuvent être atteints, en fonction de la nature de la séquence. Pour connaître la nature exacte de ce que RP-HPLC fournit en termes de pureté ainsi que les frais associés, veuillez vérifier auprès de votre professionnel des ventes ou du service client local.

Figure 1. Séparation par phase inverse : cartouche et HPLC. La cartouche standard et la purification RP-HPLC se produisent avec le 5'-DMT sur la séquence. 1) Dès l'entrée dans la colonne, la 5'-DMT hydrophobe de la séquence souhaitée s'adsorbe sur la résine en phase stationnaire. 2) Les shortmers, sans 5'-DMT et donc incapables d'interagir avec la résine, sont lessivés par la phase mobile. 3) Le 5'-DMT est clivé et la séquence souhaitée est éluée.

IE-HPLC

La chromatographie liquide à haute performance d'échange d'ions (en particulier, d'anions) (IE-HPLC) est basée sur le nombre de groupes chargés (phosphate) dans le squelette oligonucléotidique. La méthode d'échange d'anions implique l'utilisation d'une phase mobile à gradient de sel sur une phase stationnaire d'ammonium quaternaire (Figure 2). La résolution est excellente pour la purification de petites quantités. Cependant, l'IE-HPLC est limitée par la longueur, généralement jusqu'à 40 bases. Des oligonucléotides plus longs conduisent à une résolution inférieure entre la séquence complète et les séquences plus courtes et, par conséquent, une pureté inférieure et moins cohérente.

La principale raison de l'utilisation de l'IE-HPLC par opposition à la RP-HPLC est de purifier les oligonucléotides avec une structure secondaire significative, généralement présents dans les séquences à haute teneur en GC. L'IE-HPLC est efficace pour de tels oligonucléotides car la phase mobile a un pH hautement alcalin, ce qui perturbe la liaison hydrogène et, par conséquent, la structure secondaire. Cette technique peut être suivie par RP-HPLC pour ajouter une seconde dimension au processus de séparation.

Veuillez vous renseigner pour le pourcentage garanti de séquence pleine longueur.

Figure 2. Séparation par IE-HPLC. La purification IE-HPLC se produit sans la 5'-DMT sur la séquence. 1) A l'entrée dans la colonne, les phosphates polyanioniques du mélange brut forment des interactions charge-charge avec la résine polycationique en phase stationnaire. 2) Au fur et à mesure que la force ionique de la phase mobile augmente, les shortmers se lavent. 3) La séquence plus longue et souhaitée élue durent à une force ionique encore plus élevée.

L'électrophorèse sur gel de polyacrylamide (PAGE) utilise un environnement dénaturant pour séparer les oligonucléotides sur la base du poids moléculaire par opposition à la charge (figure 3). Dans des conditions appropriées, les oligonucléotides différant par une seule base peuvent être résolus. Cette excellente résolution de taille se traduit généralement par le niveau de pureté le plus élevé possible parmi toutes les méthodes de purification disponibles. Les rendements minimaux de PAGE sont inférieurs à ceux d'autres méthodes en raison de la procédure complexe requise pour extraire les oligonucléotides. Cette technique est recommandée lorsqu'une grande pureté est requise et pour des séquences ≥50 bases.

La PAGE atteint généralement une pureté de > 95 % de la séquence pleine longueur. Pour la nature exacte de ce que PAGE fournit en termes de pureté ainsi que les frais associés, veuillez vérifier auprès de votre professionnel des ventes ou du service client local.

Figure 3. Séparation via PAGE. Un champ électrique est appliqué au gel, ce qui fait que l'oligonucléotide polyanionique se déplace vers l'anode chargée positivement. Étant donné que la charge est uniformément répartie dans le mélange brut, les différentes séquences sont séparées en fonction du poids moléculaire, c'est-à-dire de la longueur. Les plus courts se déplacent plus rapidement, tandis que la séquence souhaitée plus longue se déplace plus lentement.

Filtration de gel

La filtration sur gel est recommandée pour les oligonucléotides à plus petite échelle destinés aux expériences in vivo (Figure 4). Selon le site de fabrication, les oligonucléotides phosphorothioates (S-Oligos), qui sont souvent utilisés pour les études antisens in vivo, peuvent subir une filtration sur gel (veuillez vérifier auprès de votre commercial local ou de votre service client pour savoir si ce traitement est disponible dans votre région). Cette purification élimine les traces de sous-produits de synthèse, de clivage et de déprotection (qui n'ont pas été éliminés par le dessalage standard), ainsi que les solvants de purification. Ces sous-produits à l'état de traces, généralement inoffensifs in vitro, peuvent entraîner des effets cytotoxiques in vivo.

Des options in vivo supplémentaires sont disponibles avec notre produit en plus grande quantité, iScale Oligos™.

Figure 4. Séparation par filtration sur gel. La purification par filtration sur gel se produit sans le 5'-DMT sur la séquence. 1) A l'entrée dans la colonne, le mélange de la séquence souhaitée avec divers sous-produits et impuretés du solvant traverse la résine en phase stationnaire. 2) Au fur et à mesure que la phase mobile s'écoule, les plus petites impuretés pénètrent dans les pores du gel, ralentissant ainsi leur progression à travers la matrice, la séquence souhaitée n'entre pas dans les pores du gel et traverse donc la matrice pour s'éluer en premier. 3) Les impuretés passent finalement à travers les pores du gel et la matrice et sont lavées.

Oligos de séquençage de nouvelle génération

Les méthodes de purification traditionnelles ci-dessus sont efficaces pour éliminer les impuretés de petites molécules ainsi que pour augmenter le pourcentage de séquence complète à un niveau souhaitable. Un autre type d'impureté, la contamination croisée, est devenu un problème en raison de la croissance continue de l'utilisation de techniques extrêmement sensibles, telles que le séquençage de nouvelle génération (NGS). Les méthodes de purification traditionnelles ne sont pas efficaces pour éliminer les oligonucléotides à contamination croisée.

De petites quantités de contamination croisée sont une réalité dans toute installation de fabrication d'oligonucléotides à haut débit. En règle générale, de si petites quantités n'ont pas d'impact discernable sur les techniques/applications traditionnelles, telles que la PCR. Cependant, la plupart des plates-formes NGS s'appuient sur des adaptateurs d'index (code-barres) pour le multiplexage. Si de petites quantités du mauvais code-barres (en raison d'une contamination croisée) sont ajoutées à la mauvaise cible de séquençage, le problème est indétectable jusqu'à l'étape d'analyse des données, ce qui rend ce problème coûteux en termes de temps et d'argent.

Des oligos de séquençage de nouvelle génération (NGSO) ont été développés pour éviter ce problème. NGSO est fabriqué à l'aide de méthodes de purification exclusives et est recommandé pour tout oligonucléotide destiné à être utilisé comme adaptateur NGS.


C. Estimation de la densité cellulaire pour les cellules de mammifères en culture

Les numéros de cellules doivent être déterminés à l'aide d'un compteur de cellules automatisé (par exemple, NucleoCounter™). Alternativement, les cellules individuelles doivent être comptées au microscope à l'aide d'un hémocytomètre standard (Hausser Scientific/VWR, #1483). Vous trouverez ci-dessous un protocole de base pour déterminer le nombre de cellules à l'aide d'un hémocytomètre.

1. Nettoyez soigneusement un hémocytomètre et la lamelle courte et essuyez avec de l'éthanol.

2. Si vous travaillez avec des cellules adhérentes, trypsiniser les cellules et laver une fois avec une solution saline tamponnée au phosphate (PBS). Si vous travaillez avec des cellules en suspension, culottez les cellules à 5 000 tr/min pendant 1 min.

3. Remettre en suspension les cellules dans un volume approprié de PBS pour obtenir environ 1 × 10 6 cellules/mL. Par exemple, des cellules de mammifères cultivées jusqu'à confluence dans un flacon de 25 cm2 donnent environ 2,5 × 106 cellules par flacon. Si un ballon de 25 cm 2 a été utilisé, ajouter 2,5 mL de PBS. Assurez-vous que les cellules sont complètement remises en suspension sans amas visibles.

4. Ajouter 10 L de cellules remises en suspension séparément dans deux chambres d'un hémocytomètre (sous une petite lamelle), en veillant à ce que la solution se répande complètement sous la lamelle par action capillaire.

5. Placez l'hémocytomètre sous un microscope optique, concentrez-vous sur les cellules en utilisant le grossissement le plus faible et commencez à compter les cellules uniquement aux quatre carrés d'angle et au carré du milieu dans les deux chambres de la grille de l'hémocytomètre (7). Comptez toutes les cellules sauf celles qui touchent les lignes médianes en bas et à droite. Essayez d'avoir 50 à 100 cellules par grille carrée. Si le nombre de cellules est >150/grille, diluez les cellules, nettoyez l'hémocytomètre et recomptez les cellules.


Quantification à base de colorant fluorescent

Une alternative à l'absorbance UV pour quantifier l'acide nucléique implique l'utilisation de colorants fluorescents qui se lient à l'ADNdb, à l'ARN et à l'ADNsb. Dans cette méthode, un échantillon d'acide nucléique ainsi qu'une série d'étalons de concentrations connues sont incubés avec le colorant fluorescent. Le colorant se lie à l'acide nucléique et subit un changement de conformation, ce qui entraîne une augmentation de la fluorescence à une longueur d'onde spécifique au colorant utilisé. La fluorescence est mesurée et une courbe standard (pour les lecteurs de plaques) ou un standard de référence (pour les fluorimètres portables) est créée en traçant la fluorescence par rapport aux concentrations d'acide nucléique des standards connus. La fluorescence de l'échantillon inconnu est ensuite convertie en une concentration d'acide nucléique en utilisant l'équation de régression linéaire qui décrit le mieux la courbe standard. Les échantillons peuvent être analysés dans des tubes PCR de 0,2 ml si vous utilisez des lecteurs portables tels que le fluoromètre Quantus&trade ou dans des plaques à 96 puits si vous utilisez des lecteurs de microplaques tels que le système GloMax® Discover.

Le principal avantage de l'utilisation de méthodes à base de colorants fluorescents pour la quantification de l'ARN est la sensibilité. Le spectrophotomètre NanoDrop® peut détecter aussi peu que 2ng/µl. En revanche, les méthodes à base de colorant telles que le système d'ARN QuantiFluor&trade peuvent détecter aussi peu que 100 pg (c'est-à-dire 100 microlitres d'échantillon dans un tube PCR ou une plaque à 96 puits = 1 pg/µl). Cependant, les méthodes à base de colorant ne peuvent quantifier que jusqu'à 2,5 ng/µl par rapport à 12 000 ng/µl pour l'instrument NanoDrop® (Figure 2). L'ARN purifié à partir d'échantillons à forte teneur en acides nucléiques peut nécessiter une dilution avant utilisation avec des méthodes à base de colorant. Des échantillons de 1&ndash100µl peuvent être mesurés, en fonction de la concentration d'ARN, pour conserver des échantillons précieux pour des applications en aval plus importantes. Les dosages à base de colorants sont relativement rapides et peuvent être automatisés. Les échantillons sont combinés avec le colorant et brièvement incubés. Chaque mesure ne nécessite que quelques secondes.

Un inconvénient de l'utilisation de méthodes à base de colorants fluorescents est le manque de spécificité avec la mise en garde que certains colorants fluorescents offrent une spécificité de modèle plus élevée que d'autres. Une méthode pour augmenter la spécificité consiste à incuber l'échantillon avec de la DNase pour éliminer l'ADN contaminant, améliorant ainsi la spécificité de la matrice par rapport aux méthodes basées sur l'absorbance. Les colorants utilisés par le QuantiFluor&trade RNA System et le Quant-iT&trade RiboGreen® RNA Reagent ne sont pas spécifiques à l'ARN et se lieront également à l'ADN. La présence d'ADN dans un échantillon d'ARN peut entraîner une surestimation de la concentration d'acide nucléique. Pour déterminer la concentration réelle d'ARN, nous recommandons un traitement à la DNase des échantillons d'ARN avant la mesure. Une exception est le Quant-iT&trade RNA Assay, qui utilise un colorant spécifique à l'ARN. Cependant, le test est nettement moins sensible que les autres tests, avec une limite de détection de 250 pg/µl si 20µl d'échantillon sont utilisés ou de 5ng/µl si 1µl d'échantillon est utilisé. Ainsi, la quantité d'ARN nécessaire à la mesure doit être supérieure à 5 ng pour le Quant-iT&trade RNA Assay.

Aucune information sur la pureté ou l'intégrité n'est fournie avec la quantification à base de colorant, bien que des systèmes à base de colorant distincts soient disponibles pour quantifier la quantité de protéine présente dans l'échantillon. De plus, l'utilisateur doit générer une courbe standard ou un standard de référence approprié pour les concentrations d'acide nucléique attendues des échantillons inconnus. Étant donné que la concentration de l'échantillon est inconnue, il peut être nécessaire de créer plusieurs courbes standard (c'est-à-dire une concentration élevée ou une concentration faible) pour une quantification précise. Semblables à de nombreux autres produits chimiques de laboratoire, ces colorants fluorescents sont potentiellement dangereux et une manipulation et une élimination appropriées des réactifs sont nécessaires.


Méthodes

Électrophorèse sur gel de polyacrylamide et ombrage UV

Tous les ARN ont été préparés comme dans les travaux antérieurs 24,41 par in vitro transcription avec l'ARN polymérase T7 à partir de produits PCR (avec la séquence de promoteur T7 de 20 pb TTCTAATACGACTCACTATA incluse à l'extrémité 5'), avec des volumes de transcription jusqu'à 1,5 mL. Les transcriptions ont été précipitées en ajoutant 1/10 de volume d'acétate de sodium (pH 5,2) et 3 volumes d'éthanol froid (sorti d'un stockage à -20°C), en refroidissant sur carboglace pendant au moins 15 minutes et en centrifugant à 14 000 g pendant 1,5 heures. . Après élimination du surnageant, les culots ont été rincés deux fois avec 1 ml d'éthanol froid à 70 %, séchés à l'air pendant au moins 30 minutes et resolubilisés dans de l'eau désionisée à des volumes égaux à 1/10 de la transcription originale. Un demi-volume de tampon de charge dénaturant (90 % formamide, 0,1 % xylène cyanol, 0,1 % bleu de bromophénol) a été ajouté et les échantillons ont été chargés sur des gels de polyacrylamide. Les gels avaient 0,5 mm d'épaisseur, 20 cm de hauteur (sens de l'électrophorèse) et 27 cm de largeur. Le mélange de gel contenait 1x TBE (89 mM Tris-Borate, 1 mM EDTA), 8% de polyacrylamide (29:1 acrylamide:bis, Sigma) et 7 M d'urée et a été polymérisé par l'ajout de 1/100 de volume de 10% d'ammonium persulfate et 1/1000 volume de TEMED (N,N,N′,N′-tétraméthyléthylènediamine) après avoir été versés entre des plaques de verre, les gels ont reçu au moins 1,5 heure pour polymériser. Les variations avec des temps de polymérisation plus longs et l'utilisation de mononucléotide de flavine comme réactif d'activation de polymérisation sont discutées dans la figure SI S1. Les gels ont été traités à 25 W ou moins pendant 1 à 3 heures (les températures sont restées inférieures à 40°C dans des conditions d'électrophorèse).

Les gels ont été transférés des plaques de gel sur une pellicule plastique transparente aux UV (Saran), recouverts d'une pellicule des deux côtés et placés sur une plaque TLC fluorescente (Life Technologics). Les échantillons ont été exposés à des lampes UV à main (Ultraviolet Products UVG-54, 254 nm, 6 W sauf indication contraire) et les boîtes ont été marquées sur une pellicule de plastique autour des emplacements des bandes avec des marqueurs Sharpie. Dans la plupart des cas, la moitié des voies étaient exposées, l'autre moitié étant recouverte de papier d'aluminium, les moitiés ont été excisées séparément, les parties couvertes servant de témoins non traités aux UV. L'exposition au rayonnement a été estimée en supposant que le rayonnement était réfléchi dans un hémisphère sous la lampe, diminuant au carré de la distance, c'est une sous-estimation puisque les tubes rayonnants ne sont pas des sources ponctuelles mais s'étendent sur environ 10 cm. Pour les mesures du cours du temps (Fig. 2), les premiers points temporels ont été acquis en allumant la lampe pendant quelques secondes (pour l'échauffement) et en retirant temporairement la feuille pour les temps présentés. Les tranches de gel ont été excisées avec des scalpels stériles jetables (BD) après avoir pelé la pellicule plastique et placées dans des tubes Eppendorf de 1,5 ml avec 200 pi d'eau déminéralisée. Les ARN se sont élués passivement dans l'eau pendant l'incubation pendant la nuit à 4°C et les concentrations ont été estimées par des mesures d'absorption à 260 nm sur un spectrophotomètre Nanodrop.

Transcription inversée

Les séquences d'ARN sont présentées sur la figure 1B (pour les ARN non codants) et la figure 1C (pour UV1-UV5). Toutes les séquences incluaient une séquence supplémentaire de 20 nt AAAGAAACAACAACAACAAC à l'extrémité 3' en tant que site de liaison de transcription inverse commun. La transcription inverse avec la transcriptase inverse Superscript III (Invitrogen) et l'électrophorèse capillaire sur les machines ABI 3100 et 3730 ont été effectuées comme décrit précédemment, en utilisant des billes magnétiques puristes poly (A) (Life Technologies) pour accélérer les étapes de purification 23,24,41. Pour les transcriptions inverses avec « dopage » à partir du 2′-3′-didésoxyguanosine triphosphate (ddGTP), les concentrations de nucléotides étaient de 0,05 mM de ddGTP et 1 mM de dATP, dCTP, dTTP et dITP (2′-désoxyinosine triphosphate). Les données ont été alignées et quantifiées avec le logiciel HITRACE 32 . Les données ont été déposées sous les entrées UVBAD5 UVP 0001 et TRP4P6 UVP 0001 dans la RNA Mapping Database (http://rmdb.stanford.edu).

Modèle pour les cours de temps des dommages UV

Les données pour les évolutions temporelles des dommages ultraviolets ont été adaptées à une extension du modèle de Poisson de base, dans lequel les modifications sur différents sites se produisent indépendamment et de manière stochastique [voir, par exemple, les références 23,43 pour les applications antérieures aux données de cartographie chimique]. Supposons que le taux total de modification sur tous les sites est k, et le taux de modification fractionnaire de chaque site je est donné comme kje =je k. La somme sur les taux de modification fractionnaires αje est l'unité. Le modèle à effet de peau est différent du modèle simple de Poisson en ce que les taux de dommages ne sont pas constants pour tous les ARN mais sont atténués en profondeur z avec longueur caractéristique :

La probabilité de lésion au site je au moment t est alors:

bje est le taux de fond (indépendant des UV) d'arrêt de la transcription inverse. La fraction de molécules Fm avec m lésions est donnée par la formule de Poisson, mais moyennée sur différentes profondeurs :


Procédures expérimentales

Contexte théorique

La source de contamination par les RNases lors de l'extraction d'ARN peut être exogène ou endogène 5-7. Les sources exogènes comprennent les réactifs, la verrerie et la vaisselle en plastique utilisés dans l'isolement de l'ARN, en particulier la peau de l'investigateur. Cependant, ces RNases peuvent être éliminées par des mesures judicieuses, telles que le traitement des réactifs et des ustensiles en plastique avec du pyrocarbonate de diéthyle (DEPC) cuisant la verrerie, le mortier et le pilon et le port de gants jetables tout au long de la procédure. Cependant, les RNases endogènes sont innées aux tissus biologiques et sont normalement séquestrées dans les organites et les vacuoles. Ils sont fortement régulés dans les cellules intactes, et les mécanismes de régulation sont détruits une fois que les organites et les vacuoles sont perturbés lors de la lyse cellulaire, ce qui pourrait conduire à une dégradation rapide de l'ARN 5 . Par conséquent, comment inactiver rapidement et complètement les RNases endogènes libérées est la clé d'une purification réussie d'ARN de haute qualité. Les sels de guanidinium se sont avérés être de puissants inhibiteurs des RNases 5, 7 et de nombreuses méthodes à base de sel de guanidinium ont été établies pour l'isolement de l'ARN. Cependant, certains inconvénients existent encore pour ces méthodes, tels que la perte ou la fragmentation d'ARN lors de l'extraction organique, l'interférence des réactions enzymatiques en aval par les résidus de sel de guanidinium, et un coût plus élevé pour l'expérience en raison de l'utilisation d'une concentration plus élevée de sels de guanidinium pour inactiver RNase 7 . Dans notre méthode d'isolement d'ARN précédemment rapportée 6 , nous avons essayé d'inactiver rapidement et complètement les RNases endogènes libérées pendant la lyse cellulaire ainsi que de surmonter certains inconvénients des méthodes à base de sel de guanidinium. Nos mesures comprenaient la modification de la composition du tampon d'extraction : le pH du tampon d'extraction n'a pas été ajusté avec HCl, et le pH final, y compris 0,2 m Tris, dans notre système est de 9,0. Ce pH pourrait réduire considérablement l'activité de la RNase car il ne reste que moins de 15 % de l'activité lorsque le pH est supérieur à 9,0 par rapport à l'activité maximale à un pH d'environ 7,2 dans l'eau 10 . De plus, MgCl2 et du saccharose ont été inclus dans le tampon d'extraction. Le MgCl2 a été ajouté parce que Mg 2+ sont nécessaires pour stabiliser de nombreuses structures secondaires et tertiaires dans l'ARN 11, et le saccharose a été ajouté pour maintenir une pression osmotique appropriée pour la solution. Sinon, en solution hypotonique, la fragmentation de l'ARN pourrait se produire par impact de la pression osmotique sur les ARN lors de la lyse cellulaire explosive. De plus, du phénol saturé de Tris a été ajouté immédiatement dans des poudres de tissus broyées à l'azote liquide pour inactiver les RNases endogènes libérées. Au cours de l'extraction organique suivante, le vortex a été adopté pour améliorer les effets de la dénaturation des protéines. Inclusion de MgCl2 et le saccharose dans le tampon d'extraction pourraient également éviter la menace potentielle de fragmentation des ARN, en particulier ceux à haut poids moléculaire par vortex. Pour réduire l'activité RNase introduite accidentellement pendant toute la procédure d'isolement, tous les réactifs utilisés pour la préparation de l'ARN étaient glacés, les tubes ont été pré-refroidis et les échantillons ont été maintenus sur de la glace à tout moment, sauf pendant les étapes de séchage à l'air des sédiments d'acide nucléique après centrifugation 5 .

La concentration d'acide nucléique est généralement l'étape finale dans la plupart des protocoles de purification d'ARN. Normalement, la concentration en ARN est obtenue par précipitation en présence d'ions sodium et d'éthanol. Cependant, contrairement à la précipitation spectaculaire de l'ADN génomique, des périodes d'incubation plus longues à -20 °C sont souvent nécessaires pour la précipitation de l'ARN afin d'assurer une récupération complète 5 . Dans notre protocole original, la récupération des acides nucléiques a été réalisée par précipitation à l'éthanol à -20 ° C pendant 3 heures et comprenait deux étapes de précipitation à l'éthanol, l'une pour précipiter les acides nucléiques, comprenant à la fois l'ARN et l'ADN, et l'autre pour précipiter sélectivement l'ARN 6 . L'ensemble de la procédure d'isolement a duré environ 8 heures et a été divisé en trois sessions par deux précipitations d'éthanol plus longues, ce qui rend la méthode inappropriée pour un cours expérimental de premier cycle limité dans le temps. Il existe des preuves montrant que la récupération des acides nucléiques par précipitation à l'éthanol n'est pas significativement améliorée par une incubation longue ou basse température, mais par un temps de centrifugation plus long 9 . Par conséquent, l'incubation plus longue à basse température (à -20 °C pendant 3 h) a été remplacée par une incubation à 0 °C pendant 10 min, et le temps de centrifugation après la précipitation à l'éthanol a été réglé à 15 min pour obtenir une bonne récupération. En conséquence, la durée de la procédure d'isolement a été considérablement réduite (en 2,5 heures, par rapport à 8 heures de notre méthode d'origine), tandis que la récupération de l'ARN était comparable à notre méthode d'origine (données non présentées).

Étant donné que le succès de nombreuses applications basées sur l'ARN en aval repose sur l'obtention d'ARN de haute qualité, il est nécessaire d'évaluer la qualité de l'ARN purifié avant de procéder à des tests en aval. Par conséquent, la quantité, la pureté et l'intégrité des échantillons d'ARN doivent être vérifiées avec des méthodes appropriées. L'ARN a une absorption maximale à 260 nm, et la concentration d'ARN pourrait être quantifiée par spectrophotométrie par la relation 1 UNE260 = 40 µg d'ARN mL -1 . Les protéines et les polysaccharides/polyphénols contaminés ont des valeurs d'absorption maximales à 280 et 230 nm, respectivement, de sorte que les rapports de UNE260/UNE280 et UNE260/UNE230 pourraient être utilisés comme indicateurs de ces contaminants. De plus, ces contaminants pourraient entraîner des écarts par rapport au spectre d'absorbance standard avec le profil d'absorption UV caractéristique des échantillons d'ARN pur, ce qui n'est pas observable lors de la mesure de l'absorbance uniquement aux trois longueurs d'onde ci-dessus. Par conséquent, outre les rapports d'absorption, l'analyse du spectre d'absorbance UV de l'ARN purifié de 220 à 350 nm a été introduite pour évaluer la pureté de l'ARN. Pour vérifier l'intégrité de l'ARN, la méthode typique consiste à visualiser le profil de bandes de bandes d'ARN séparées par la taille à travers un gel d'agarose dans des conditions dénaturantes. Cependant, c'est un processus qui prend du temps en raison de la procédure compliquée, et la visualisation des bandes d'ARN ne peut pas non plus être réalisée immédiatement après l'électrophorèse 8 . Un gel d'agarose standard, bien qu'il ait une résolution plus faible pour les ARN non dénaturés riches en structures secondaires et tertiaires, a l'avantage d'être facile à compléter et capable de visualiser l'ARN immédiatement après l'électrophorèse en incluant du bromure d'éthidium (EtBr) dans le gel. Par conséquent, l'électrophorèse d'ARN non dénaturé à travers un gel d'agarose standard a été utilisée pour vérifier l'intégrité de l'ARN dans ce rapport. Cependant, il convient de noter que la meilleure performance de la séparation de l'ARN total dans des conditions non dénaturantes ne pouvait être obtenue qu'en exécutant des échantillons d'ARN avec des quantités inférieures (généralement moins de 5 g) à travers une concentration plus élevée de gel d'agarose (généralement 1,5 %).

Arrangement

Les élèves ont travaillé en binôme dans le laboratoire. Le traitement sans RNase a été réalisé avant l'expérience par des étudiants individuels. Environ 1 heure de cours préparatoire et de discussion axée sur les précautions spécifiques à prendre avec l'ARN, et la justification de l'établissement du protocole original et les modifications apportées aux méthodes d'isolement de l'ARN et de l'analyse de contrôle de la qualité de l'ARN utilisées dans ce rapport ont été fournies et suivies d'un Exercice pratique en laboratoire de 4 heures. L'ensemble de la procédure pourrait également être divisé en deux sessions d'isolement d'ARN et d'analyse de contrôle de qualité de l'ARN.

Matériaux et solutions

L'équipement suivant est requis pour l'expérience : mortier et pilon, spatules de laboratoire en acier inoxydable, tubes à centrifuger de 50 ml, pipettes, vortex, embouts et gants jetables, centrifugeuse (Thermo Fisher Scientific, Am Kalkberg, Allemagne, Sorvall ST 16R), 1,5 ml Tubes Eppendorf, spectrophotomètre à faible volume (NanoDrop Technologies, Wilmington, DE, Nanodrop 2000c), installations d'électrophorèse sous-marine (Bio-Rad, Hercules, CA, Sub Cell GT) et système d'imagerie sur gel (Bio-Rad, Hercules, CA, Gel système Doc XR). Le traitement sans RNase a été effectué comme suit : tous les tubes et embouts ont été trempés dans du DEPC à 0,1 % pendant une nuit à 37 °C, puis autoclavés à 121 °C pendant 20 min. Les mortiers et pilons ainsi que les spatules de laboratoire en acier inoxydable ont été cuits à 180 °C pendant 12 h.

Les réactifs suivants étaient nécessaires pour l'isolement de l'ARN : tampon d'extraction d'ARN (0,2 m Tris, 0,4 m KCl, 0,2 m saccharose, 35 m m MgCl2, 25 mm EGTA), Tris-phénol saturé (pH 8,0), chloroforme/alcool isoamylique (24:1, v/v), 3 m NaAc (pH 5,2), 3 m NaAc (pH 5,6), 0,3 m NaAc (pH 5.6) et eau traitée au DEPC. Des solutions de NaAc et de l'eau traitée au DEPC ont été préparées en traitant des solutions de NaAc et de l'eau avec 0,1 % de DEPC pendant une nuit à 37 °C, puis autoclavées à 121 °C pendant 20 min. Le tampon d'extraction d'ARN a été préparé avec de l'eau traitée au DEPC.

Les réactifs suivants étaient nécessaires pour l'analyse de l'ARN : agarose, 1 × TAE, 10 × tampon de charge d'ARN (1 m m EDTA, 0,25 % de bleu de bromophénol, 0,25 % de xylène cyanol, 50 % de glycérol) et 10 mg/mL d'EtBr. Les solutions pour l'électrophorèse d'ARN n'ont pas été administrées avec le traitement sans RNase car les bandes de RNase et d'ARN ont une mobilité différente dans les gels d'agarose, ce qui signifie qu'elles pourraient être séparées une fois qu'un champ électrique est appliqué.

Lyse cellulaire, dissociation des nucléoprotéines, dénaturation et élimination des protéines

La procédure suivante peut être appliquée à une grande variété de tissus végétaux herbacés. Pour les tissus végétaux riches en polysaccharides et/ou polyphénols, des protocoles de purification spécifiques doivent être adoptés, comme la méthode modifiée au bromure de cétyltriméthylammonium 12 .

Récupérez 1 g de chou blanc chinois (Brassica campestris L. ssp. chinensis Makino [var. communis Tsen et Lee]) feuilles et les broyer dans de l'azote liquide dans un mortier prérefroidi en une poudre fine. Do not let the tissue thaw and immediately transfer the powder to a 50-mL centrifuge tube, add 2 mL of Tris-saturated phenol (pH 8.0) immediately, then 4 mL of extraction buffer and 2 mL of chloroform/isoamyl alcohol (24:1, v/v) sequentially (phenol should be added first to establish a denaturation environment for the endogenous RNases to be released into). Vortex the tube until a complete emulsion was formed. Centrifuge at 8,000 × g pendant 5 min à 4°C. Carefully transfer aqueous phase to another 50-mL centrifuge tube, then add 2 mL of phenol and 2 mL of chloroform/isoamyl alcohol (24:1, v/v), mix vigorously and centrifuge at 8,000 × g pendant 5 min à 4°C. Take the upper phase and add 4 mL of chloroform/isoamyl alcohol (24:1, v/v), then mix and centrifuge the sample as before. Transfer the upper phase to a 50-mL centrifuge tube and record the volume that was transferred.

Selective RNA Precipitation

Combinations of ethanol and NaAc (pH 5.6) were used to selectively precipitate the RNA. First, add 0.1 volume of NaAc (pH 5.2) and 2.2 volumes of ethanol precooled at −20 °C to the transferred aqueous phase and mix it by inversion several times. After embedding the tubes in crushed ice for 10 min, centrifuge them at 15,000 × g for 15 min at 4 °C. The nucleic acids were spun onto the wall of the centrifuge tube. After centrifugation, decant the liquid and mark the location of nucleic acid sediments on the outer wall of the tube. Invert the tube and place it on a filer paper to allow it to air-dry to remove residual ethanol. Resuspend the nucleic acid sediments with 1 mL of 3 m NaAc (pH 5.6) using a pipette, then transfer the resuspended nucleic acid to a 1.5 mL Eppendorf tube. Centrifuge the tube at 15,000 × g for 10 min at 4 °C, carefully decant and discard the supernatant, place the tube invertedly on a filter paper to air dry the nucleic acids. Redissolve the sediment in 400 μL of 0.3 m NaAc (pH 5.6) and add 1 mL of ethanol precooled at −20 °C, mix the tube by inversion several times, embed the tube in crushed ice for 10 min, then centrifuge the tube at 15,000 × g for 15 min at 4 °C. Wash the RNA pellet twice with 200 μL of 70% ethanol, then air-dry and dissolve the pellet in 50 μL of DEPC-treated water.

RNA Quality Assessment by Spectrophotometer

The RNA was analyzed on a NanoDrop 2000c spectrophotometer according to the manufacturer's instructions. An absorbance spectrum was obtained from 220 to 350 nm, the RNA concentration was calculated with the equation 1 UNE260 = 40 µg RNA mL −1 , and ratios of UNE260/UNE280 et UNE260/UNE230 were calculated to evaluate the purity of the RNA samples that were extracted.

Agarose Gel Electrophoresis

Dilute 10 μL of RNA samples to 1 µg/μL with DEPC-treated water according to the quantification results, 0.5, 1, 2, and 4 µg of RNA aliquots were taken out and adjusted to 9 µL with DEPC-treated water, then 1 µL of 10 × RNA loading buffer was added. After mixing the samples, all aliquots were loaded onto a 1.5% TAE agarose gel containing 0.5 µg/mL EtBr. Electrophoresis was carried out in 1 × TAE at 5 V/cm until the dye front had migrated two-thirds of the way down the gel. The gel was photographed with a Gel Doc XR System (Bio-Rad).

Assessment of Student Learning

Three methods were applied to assess student learning from the experimental exercises: Lab reports after the experiment, a lab presentation at the beginning of the next experimental class, and a short summary after the whole experimental course. In their lab reports, students were required to state the purpose and the principles of the experiment, concisely state the results that were obtained, including the yield in μg RNA/g of fresh weight of the leaves, the ratios of OD260/OD280 and OD260/OD230, and the results of the electrophoresis of nondenatured RNAs in a standard agarose gel in a figure, as well as state the key of the protocol design and the experimental operation, especially how to prevent RNase contamination, and state what conclusions they can make based on their data. In addition, six groups out of 15 were randomly selected to give a presentation before the whole class about their results and experiment. Thus, all of the groups could mutually compare their results and, if necessary, discuss their experimental experience. In their summary, they should list what they had learned, including their grasp of experimental skills and reinforcement of the fundamental concepts.

Hazards

The liquid nitrogen used for freezing plant tissues needs to be handled carefully. Phenol and chloroform can easily evaporate, even at room temperature, and these two reagents as well as their vapors are corrosive to the eyes, the skin, and the respiratory tract. EtBr is mutagenic and should be used with caution. Phenol, chloroform, and DEPC are carcinogenic and should be handled with extreme care. Students were required to wear lab coats and closed-toed shoes in the lab as well as disposable gloves throughout the whole procedure.


Ion Exchange

Ion exchange chromatography is broken in to two types - anion & cation exchangers. There are many different types of moieties that are used from weakly to very strongly charged thus allowing a huge range of molecules the ability to interact.

Unlike gel filtration chromatography, here proteins directly interact with the resin. So generally the column is equilibrated in a buffer solution to establish a constant pH in the column, then the protein mixture is loaded where all or some of the proteins interact with the resin depending upon their own charge. Buffer is continued to be applied until all proteins not interacting with the resin have been washed off. At that point usually a gradient of increasing salt concentration (disrupts ionic and hydrogen binding) in the buffer is applied to column allowing the most weakly interacting proteins to release first followed by the more strongly and finally the most strongly interacting. This can also be accomplished by changing the pH of the buffer being applied to the column.

Anion Exchanger

Anion exchanger means that it removes anions from protein mixture so that means the resin must be decorated with positively charged moieties. Before elution begins all positively and uncharged proteins will fall through the column. When you start eluting, first you will knock off the weakly negative proteins (e.g. -1 charge), followed by those with a stronger negative charge (-2), and finally the most negatively charged proteins (-3).

Cation Exchange

It is exactly oppose with a cation exchanger -- here cations are removed from the protein solution so the resin must be negatively charged. Again before elution begins all negatively and uncharged proteins will fall through the column. When you start eluting, first you will knock off the weakly positive proteins (e.g. +1 charge), followed by those with a stronger positive charge (+2), and finally the most positively charged proteins (+3).


The need for high purity oligonucleotides

According to Balasubrahmanyam Addepalli , research associate professor at the University of Cincinnati, despite the increasing use of oligonucleotides, it is still challenging to purify them due to "failure sequences and final products with intact protective groups."

The synthesis of oligonucleotides using techniques like solid-state synthesis can introduce tiny amounts of impurities at each step of the synthesis cycle. As the length of the oligonucleotide increases, the yield of the pure product decreases. Modifications to oligonucleotides – such as attachment of polyethylene glycol to enhance stability and bioavailability – can also introduce impurities during the synthesis process.

The more common impurities are:

    n-1 shortmers due to reaction failures


A review by Goodchild eloquently summarizes the established technique for oligonucleotide synthesis which has been automated since the 1970s. 3 As the use of oligonucleotides increases, it becomes increasingly important to adopt efficient methods to purify, analyze and characterize them.


Activités

VIRTUAL LAB

DNA Microarray Virtual Lab “DNA microarray analysis is one of the fastest-growing new technologies in the field of genetic research. Scientists are using DNA microarrays to investigate everything from cancer to pest control.” (Genetic Science Learning Center, University of Utah) Task: Complete the DNA Microarray Virtual Lab. In the virtual lab you will conduct a microarray experiement in which you will use a DNA microarray to investigate the differences between a healthy cell and a cancer cell. “The Virtual Lab is broken up into three chapters. Chapters One and Two will give you some background and review a couple of important principles that are essential to the understanding of DNA Microarrays. Chapter Three is the actual experiment. Before you head into the lab, it is highly recommended that you take a look at Chapter One – Genomics: a New Science and Chapter Two – Measuring Gene Expression.

In Chapter Three you will carry out the experiment. The experiment is divided into seven steps:

  1. Isolate RNA
  2. Isolate mRNA
  3. Make Labeled DNA Copy
  4. Apply DNA
  5. Scan Microarray
  6. Analyze Data

Task: Upon completion of the virtual lab, explain in detail specifically why DNA microarray analysis is a powerful tool in genomics. In addition, while DNA microarray is an extremely useful molecular biology technique that can generate significant amounts of data it does have some limitations. Identify and briefly explain some of the limitations to DNA microarray analysis.


Voir la vidéo: Visualization des resultants par électrophorèse en Gel dAgarose (Août 2022).