Informations

Que se passe-t-il si nous injectons une enzyme de restriction dans le sang

Que se passe-t-il si nous injectons une enzyme de restriction dans le sang


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Juste une question curieuse, si nous extrayons l'enzyme de restriction et l'injectons dans notre corps, que se passe-t-il ?

  • L'anticorps le reconnaît-il et le bloque-t-il ?
  • L'enzyme de restriction peut-elle traverser la membrane cellulaire et détruire l'ADN d'une cellule vivante ?

L'apparition de tout antigène étranger (par exemple, les protéines comme les enzymes de restriction tombent dans cette catégorie) dans le système circulatoire devrait déclencher une réponse immunitaire.

Il existe en fait deux barrières membranaires que les enzymes doivent traverser pour accéder au génome nucléaire : la membrane cellulaire et la membrane nucléaire. Les protéines sont généralement trop grosses et trop chargées pour traverser une membrane lipidique bicouche - à moins qu'il n'y ait un pore (comme sur la membrane nucléaire) ou un récepteur pour la protéine à la surface cellulaire.

Lorsque les cellules sont modifiées pour exprimer des enzymes de restriction étrangères à l'aide de transgènes, alors oui, si la protéine peut entrer dans le noyau, l'enzyme commencera à digérer tous ses sites de reconnaissance.

Jasper Rine l'a démontré pour la levure de boulanger S. cerevisiae en 1986.


Découverte d'enzymes de restriction

Téléchargez la vidéo depuis iTunes U ou Internet Archive.

OK, donc j'aimerais passer maintenant au segment suivant du cours.

Je pense que vous pouvez probablement mieux apprécier ce triangle que j'avais auparavant sur la façon dont les biochimistes avaient tendance à ouvrir les cellules, à regarder les composants, à travers d'autres choses là-dedans, puis les protéines.

Mais beaucoup de choses liées à la fonction sont les protéines, et ce que les généticiens, la discipline de la génétique feraient, qui a fait des mutants d'organismes vivants, et qui a examiné comment la fonction était affectée par la mutation de gènes individuels, comment ceux-ci étaient tous les deux très approches puissantes. La génétique vous a dit ce qui était vraiment important, et la biochimie vous a dit comment cela fonctionnait au niveau moléculaire, mais le vrai problème est de savoir si cette chose que vous aviez en train de faire quelque chose dans le tube à essai était réellement celle qui l'a fait dans la vie.

Et je pense que ça ira quand Arthur Kornberg a isolé la toute première ADN polymérase, il était capable de copier l'ADN. Et il a obtenu un prix Nobel, et c'était la première enzyme qui pouvait copier l'ADN, puis John Karens a créé un mutant qui manquait de l'enzyme. Et l'organisme était toujours vivant.

Par conséquent, cela ne pouvait pas être l'ADN polymérase qui copiait le chromosome. En fait, il s'agissait d'une enzyme de réparation de l'ADN. Donc, si vous pouvez réellement unir la génétique et la biochimie, si vous pouvez prendre un mutant qui est brisé dans une fonction et que vous trouvez que votre protéine manque, ou vice versa, alors vous avez une idée très, très puissante parce que vous reliez votre connaissance de ce que était physiologiquement important pour la biochimie que vous faites. Mais c'était vraiment, vraiment difficile pendant des années, et ce n'est que dans de très rares occasions que certains généticiens ont eu un mutant qui suggère si fortement que certains biochimistes regarderaient, ou certains biochimistes auraient un résultat si puissant qu'ils ont parlé à un généticien et ont vu si quelqu'un avait trouvé le résultat.

Et le pouvoir de l'ADN recombinant, bien qu'il ait lancé une industrie biotechnologique, et qu'il ait rendu possible le séquençage du génome, il y a un autre niveau supérieur dans la compréhension conceptuelle.

Et ce qu'il a fait, c'est qu'il vous a permis d'aller et venir entre ici et ici.

Vous n'auriez aucun problème maintenant si je vous donnais le séquençage du gène, vous pouvez le commander. Vous pouvez le coller dans une cellule et produire des quantités massives de protéine. Vous l'avez purifié vingt fois et ce serait pur, alors qu'avant vous auriez pu le purifier quinze mille fois sur 1000 g de cellules, et vous auriez dû être un très bon biochimiste avec 15 étapes pour purifier ce. Donc, vous pouvez passer de la séquence du gène à la protéine, ou si nous avons une protéine et que nous voulons savoir quel gène nous allons simplement séquencer une partie de la protéine, utiliser ce code génétique, nous retourner vers certains possibles séquences, puis allez chercher les séquences, puis allez trouver le gène. Donc, ce que l'ADN recombinant nous permet de faire, c'est de boucler cette boucle. Vous pouvez passer de la génétique à la biochimie dans les deux sens. Maintenant, tout le monde fait tout au lieu d'être des disciplines isolées, comme c'était le cas lorsque je suis entré sur le terrain. Donc, tout dépendait du développement pour cloner des morceaux particuliers d'ADN.

Et je tiens à préciser dès le début, il y a quelques utilisations du clonage qui sont couramment utilisées en ce moment. Ce dont nous parlons dans cette conférence, c'est de cloner un morceau d'ADN. Ce que cela signifie, c'est que je vais prendre un segment particulier d'ADN, disons, le couper ici et le couper là.

Et je vais prendre ce morceau, et je vais lui faire quelque chose qui me permette de l'amplifier et de faire beaucoup, beaucoup de copies de ce morceau d'ADN. Et le clonage de n'importe quoi d'autre, vous faites un tas de copies.

C'est donc une utilisation du mot clonage.

L'autre utilisation, que vous voyez tout le temps dans la presse populaire, est le clonage d'un individu, mais n'étant pas là mais vous prendriez le noyau de la cellule de l'individu, il a mis ce noyau dans un œuf qui n'avait pas son propre noyau déplacé, et maintenant vous espérez que ce que vous obtenez est un organisme qui a tout le même contenu génétique que l'individu de départ.

Et en fait, même si cela semble très bien sur papier, vous commencez probablement à voir que ce n'est pas la panacée que les gens pensaient que c'était, ou que nous devrions nous inquiéter que dans 10 ans, tous mes étudiants du MIT seraient des clones de la personne la plus brillante de la classe ou quelque chose comme ça, parce que d'autres choses arrivent, parce qu'à moins que vous ne suiviez des cours de biologie avancés, mais il y a des modifications de l'ADN. Il y a toutes sortes de choses qui lui arrivent, donc ce n'est pas identique.

Et tant de ces organismes clonés, comme Dolly la brebis, qui était célèbre, sont morts tôt avec, j'oublie, l'arthrite et tout. Donc, il y a beaucoup de problèmes de ce côté-là. Mais c'est l'autre utilisation du mot clonage et ce n'est pas de cela que ces trois prochaines conférences parlent du clonage d'un morceau d'ADN. Et c'était le gros problème auquel était confronté le domaine, certainement quand j'étais étudiant de premier cycle et même quand j'étais étudiant diplômé, je m'intéressais à la synthèse de morceaux d'ADN, et c'était l'une de ces choses que les gens disaient, pourquoi le faites-vous ? Eh bien, parce que vous pourriez essayer de le faire. Et si vous aviez un morceau d'ADN, comme Gobind Khorana, qui est mon collègue, qui a reçu le prix Nobel pour avoir synthétisé le premier gène.

Il l'a synthétisé. C'était un gène d'ARNt qui avait 120 paires de bases de nucléotides de long ou quelque chose comme ça. Il l'a synthétisé.

Il avait montré que vous pouviez le faire. Mais vous ne pouviez rien faire avec.

Et il y avait en quelque sorte deux gros problèmes. L'un était le fait que cet ADN, bien que ce ne soit pas un tétranucléotide monotone.

C'est assez difficile à dire. Chacune de ces choses est une paire de bases, et l'ADN humain en contient 3 milliards. Et un peu ici, ça n'a pas l'air très différent de celui là-bas.

Et ça n'aurait certainement pas l'air très différent du morceau d'ADN qui se trouve à 2 milliards de paires de bases de l'autre côté du campus ou quelque chose du genre. Donc, il n'y a aucun moyen de prélever de l'ADN et de le couper de manière reproductible, donc vous obtenez des fragments.

Ce que vous pouviez voir à partir des premiers principes, c'est que vous auriez besoin de ciseaux magiques. Et à quoi ressembleraient les ciseaux ? Eh bien, il faudrait des ciseaux qui pourraient être séquencés parce qu'il n'y a rien d'autre de différent. Vous savez que c'est une épine dorsale régulière, et ce n'est que quatre nucléotides. Donc, si vous vouliez couper l'ADN à des endroits particuliers, vous deviez avoir des ciseaux qui pouvaient voir une séquence.

Et de plus, vous pouvez voir qu'ils ne pouvaient pas simplement, il y a les parties de liaison hydrogène de l'ANT ou du GNC parce qu'elles sont collées ensemble au milieu de l'ADN.

Donc, vous auriez besoin de ciseaux qui pourraient d'une manière ou d'une autre trouver une séquence et faire une coupe. Et ceux-ci ont été trouvés. Je vais vous parler de ça.

On les appelle des enzymes de restriction. Donc ça faisait partie du truc. L'autre chose était, imaginez que je pourrais découper ce fragment. Et ils te l'ont donné, et j'ai dit, super. Maintenant, je l'ai.

Voudriez-vous me faire beaucoup de copies de cet ADN ?

Pourriez-vous le faire? Disons que vous savez maintenant comment transformer le principe que nous avons vu avec Avery.

On pourrait prendre de l'ADN nu et mettre ce fragment dans la cellule.

Cela se reproduirait-il ? Qu'est-ce que tu penses? Quelqu'un s'en souvient ?

Non? OK, nous avons parlé d'autres langues, n'est-ce pas ?

Mais l'une des choses qui sont dans l'ADN est le code génétique avec tous les gènes. Et nous pouvons trouver le cadre de lecture. Souvenez-vous quand nous parlions d'une origine de réplication. J'ai dit que c'était en quelque sorte, au moins pour E. coli, il y a une origine. Chez les eucaryotes, les origines sont espacées le long de l'ADN. Et chaque fois que vous avez un cycle de réplication, cela commence par l'une de ces origines, puis s'en va.

Donc, la chance que ce morceau d'ADN par hasard ait une origine est assez faible. Donc si je le mets dans un organisme, il va rester là, si vous avez de la chance, le dégrader parce qu'il a des [mélanges? , ou même si j'en faisais un cercle, il ne se répliquerait probablement pas parce qu'il n'a probablement pas le mot dans l'ADN qui dit de commencer un cycle de réplication de l'ADN.

Donc, l'autre principe fondamental de la réplication de l'ADN est que vous devez d'une manière ou d'une autre prendre le fragment d'ADN que vous regardez, et vous devez l'attacher à une origine de réplication.

Maintenant, si vous avez une origine de réplication et que vous avez un fragment d'ADN, et que vous le mettez dans la cellule, vous obtiendrez maintenant un grand nombre de copies de ce morceau d'ADN. C'est donc ça l'ADN recombinant sous une forme vraiment très simple. Je vais juste vous amener maintenant à augmenter les niveaux de détail.

Alors, laissez-moi vous donner en quelque sorte une vue très large de ce clonage, puis nous commencerons en quelque sorte à plonger dans certaines des techniques les plus sophistiquées qui en ont découlé.

Nous parlerons du séquençage de l'ADN, de la PCR et d'autres choses dans la prochaine conférence. Donc le premier principe ici est de couper l'ADN, et je sais que vous pouvez penser que c'est une sorte de bavardage, mais c'est comme ça que je pense. Si vous pensez vraiment à ce genre de choses, c'est ce que c'est vraiment. Avec des ciseaux moléculaires spécifiques à une séquence, ceux-ci ont un nom plutôt étrange.

On les appelle des enzymes de restriction. Je ne sais pas si l'un d'entre vous sait pourquoi on les appelle enzymes de restriction, et même si je suis sûr que certains d'entre vous les ont utilisées dans leur opération pour découper des morceaux d'ADN.

Mais ce que ça fait, ce sont des enzymes, comme je vais vous le dire, qui reconnaissent une séquence particulière. Et ils coupaient toujours à cette séquence. Dans la valeur de cela, vous pouvez couper l'ADN de manière reproductible exactement au même endroit, et les taches sont spécifiées par n'importe quelle séquence que cette paire de ciseaux particulière sait lire.

Ensuite, la prochaine chose que nous devons faire est de joindre le morceau d'ADN à une origine de réplication. Ainsi, la chose qui porte l'origine de la réplication s'appelle un vecteur. Et généralement, pas toujours, ce sont des cercles. Nous considérerons que ceux qui se développent dans E. coli sont la plupart du temps, ou dans des bactéries, principalement des cercles.

Ce sont eux qui sont largement utilisés pour la plupart des clonages.

Donc, nous allons parler de ceux-ci. Qu'est-ce qui fait un vecteur ? Quand il doit avoir, c'est une origine de réplication de l'ADN. Ils ont généralement autre chose. Nous pourrions l'appeler un marqueur sélectionnable, mais quelque chose comme une résistance aux médicaments.

Si l'un d'entre vous a fait du clonage dans un UROP, il s'agit généralement d'un gène qui rend la cellule résistante à l'ampicilline ou à la tétracycline, un antibiotique qui tuerait normalement la cellule.

Vous pouvez donc dire si cette cellule a ce vecteur ou non parce que la cellule commence à l'une ou l'autre sensibilité à l'ampicilline.

Il acquiert le vecteur qui le réplique, acquiert également le gène qui lui confère la résistance aux médicaments.

Mais si nous allons couper cela, si nous allons joindre un morceau d'ADN à cela, nous ne pouvons pas former un cercle sans le briser.

Nous devons donc couper le vecteur sur un site unique. Et nous utiliserions une enzyme de restriction pour cela. Et vous pouvez également voir qu'en concevant un vecteur, vous voudriez quelque chose qui n'a qu'un seul site.

Donc, ce que nous aurions obtenu à partir de cela conceptuellement comme nous l'avons maintenant, c'est le vecteur, son origine de réplication ici, et disons la résistance à l'ampicilline, par exemple, en tant que marqueur sélectionnable, le gène pour cela pourrait être codé ici. Et nous avons le fragment de, si vous voulez, posez-le simplement sur le sol, je pense. Nous avons fait le point à ce stade. Merci.

Ce qu'il faut faire, c'est joindre ce morceau d'ADN à cela.

Et nous allons passer aux détails moléculaires de cela.

Mais, nous allons joindre le fragment au vecteur, et en fait c'était quelque chose qui était déjà dans les boîtes à outils des biologistes moléculaires, qui étudiaient la réplication de l'ADN. C'est de l'ADN ligase.

Lorsque nous avons terminé un fragment d'Okazaki, nous avons dû sceller [ININTELLIGIBLE] et l'enzyme qui l'a fait était une enzyme appelée ADN ligase.

Ainsi, les biologistes moléculaires avaient essentiellement du scotch ou de la colle pour recoller les éléments. Ce qui leur manquait pendant de très nombreuses années, c'était la séquence des ciseaux moléculaires spécifiques.

Donc à ce stade, si nous faisions de l'ADN recombinant, nous avons maintenant un vecteur. Nous avons maintenant un morceau d'ADN qui s'y rattache. En fait, nous avons probablement tout un autre gâchis de choses qui se produisent en cours de route.

Mais pour le moment, ils sont dans un tube à essai.

Donc, si nous voulons que cette chose grandisse, que devons-nous faire ensuite ?

Nous allons devoir obtenir l'ADN de l'extérieur de la cellule à l'intérieur de la cellule. C'est le mot dont nous avons besoin pour transformer l'ADN en une cellule.

Encore une fois, le mot transformer, qui remonte à ces expériences de transformation avec le Streptococcus pneumonia passant de lisse à rugueux, et vous prenez des trucs de la cellule qui les a transformés de rugueux à lisse, peu importe, c'est de là que vient le mot, mais nous savons maintenant qu'il obtient de l'ADN nu à l'intérieur de la cellule où il peut être répliqué.

Et puis la prochaine chose que nous devons savoir, c'est quelles cellules ont acquis ce vecteur au moins en tant que vecteur.

Nous nous contenterons de cela au début, et pour ce faire, vous devez sélectionner le marqueur sur le vecteur. Dans le cas de celui-ci, nous commencerions par une souche qui a tué mon ampicilline, puis nous jouerions simplement et demanderions des gars qui sont résistants à l'ampicilline. Et, vous pouvez voir qu'il y a une autre classe de problèmes parce que si nous avions un vecteur non coupé, et il y aurait probablement, à coup sûr, une partie de cela dans notre mélange, cela ferait les cellules de l'ampicilline. Et si on avait un insert, ce serait aussi l'ampicilline. Donc, si nous voulions vraiment entrer dans ce domaine, nous devrons faire un peu plus de travail pour trier ce qu'il y a là-bas.

Mais c'est le truc de base. Je soupçonne que la plupart d'entre vous le savent pratiquement depuis la maternelle. Mais c'est le cadre global dans lequel, maintenant, je vais commencer à superposer différents détails. Et la partie suivante, encore une fois, certains d'entre vous le savent peut-être. Je ne pense pas que ce sera un concept totalement étranger. Vous êtes probablement familier avec cela, que sont ces enzymes de restriction ? Le mot réel est endonucléase de restriction. Ils sont souvent appelés enzymes de restriction dans un laboratoire [parlons?]. La nucléase est quelque chose qui coupe l'acide nucléique, et l'endonucléase est celle qui n'a pas besoin d'extrémité libre. Ainsi, il peut couper au milieu de la séquence au lieu de grignoter à la fin. Ce serait une exonucléase. Donc, ces choses ont des noms qui ont tendance à être quelque chose comme ECO-R1, qui a quelque chose à voir avec l'endroit d'où elles sont dérivées. Et un exemple typique, l'un des tout premiers qui est encore très largement utilisé, est ECO-R1.

Et cela reconnaît la séquence G A A T T C.

Maintenant, vous remarquerez que si vous lisez la séquence de cette manière, c'est la même séquence lorsque vous la lisez sur l'autre brin.

C'est ce qu'on appelle un palindrome mais attention car les palindromes en anglais, ce sont des mots que l'on lit d'avant en arrière ce sont les mêmes. Dans une lettre anglaise, peu importe que ce soit un A ici ou un A là.

Mais vous savez quelque chose sur la structure de l'ADN.

Il y a une polarité principale de cinq à trois. Donc, lire de cette façon ne ressemble pas du tout à la même chose. C'est totalement différent.

Mais en lisant ce volet, nous disons que c'est cinq à trois.

Ce qui est identique, c'est la séquence réciproque de l'autre côté. Donc il y a ceci, vous voyez G A A et G A A mais ce n'est pas comme le mot anglais palindrome, alors mélangez-vous à ce sujet.

Quoi qu'il en soit, ce que cela fera alors, ce que cette enzyme fait alors, c'est qu'elle coupe sur le côté ici. Il coupe symétriquement.

Et ce qu'il génère, c'est un hydroxyle G trois premiers.

Vous vous souvenez du ribose ? Si nous avons, disons, un A là, c'est la position trois premiers, et c'est la position cinq premiers dans le sucre. Ainsi, il laisse un hydroxyle trois premiers et laisse également un phosphate cinq premiers.

Donc, nous aurions A A T T C ici, et puis de l'autre côté, nous aurions la chose réciproque. Donc, nous aurions G avec un hydroxyle trois premiers, puis sur A A T T C comme ça.

Alors maintenant, nous avons une pause ici. Nous pouvons les séparer. Mais l'une des choses intéressantes que vous pouvez voir à partir de cela est que nous générons cinq extrémités monocaténaires de premier ordre, et celle-ci est la séquence AATT C. C'est AATTC ici, et ces gars-là, s'ils pouvaient se réunir et s'aligner comme ils le feraient ici, ils seraient capables de former des liaisons hydrogène. Donc, si vous prenez une enzyme comme ECO-R1, et que nous prenions, disons, un cercle qui avait un seul site ECO-R1, G A A T T C, si nous le coupions avec l'enzyme de restriction, nous ferions [des entailles?]. Et si nous gardions un rhume, tout ce que nous aurions, ce sont des pseudos ADN. Et si nous réchauffons un peu les choses, il n'y a que quatre liaisons hydrogène qui maintiennent cela ensemble.

Ainsi, la chose se linéariserait et s'effondrerait simplement dans la brise.

Si nous le refroidissions lentement, l'état thermodynamiquement le plus favorable, l'état d'énergie la plus basse, serait avec ces extrémités qui se rejoignent. Ainsi, nous pourrions ensuite ajouter de l'ADN ligase.

Si nous les ajoutions et que nous ajoutions de l'ADN ligase, nous pourrions inverser le processus et faire des allers-retours, ECO-R1 pour le couper, l'ADN pour le ligaturer.

Et puis, la beauté de l'ADN recombinant est que cette partie qui se rejoint ne voit pas ce qu'il y a ici ou ce qui est là-bas.

Tout ce qu'il voit, ce sont les petits bouts qui sont générés par un site ECO-R1.

Alors ils prennent une partie de mon ADN, et je vais la découper.

J'obtiendrai un zillion de fragments ECO-R1, mais ils auront tous le même petit surplomb qui est complémentaire au vecteur.

Donc, si je prends un vecteur coupé avec ECO-R1, et que je prends un peu de mon propre ADN et que je les mélange, je peux obtenir un petit fragment, me mettre entre le vecteur, et il fait exactement cette jonction que je schématais ici . Encore une fois, c'est la découverte de ces enzymes de restriction qui a rendu possible presque tout ce qui s'est passé en biologie depuis 1975. Le développement des enzymes de restriction était essentiellement, j'étais un post-doctorant à Berkeley à ce moment-là et les laboratoires, Stan Cohen à Stanford , Herb Boyer de l'UCSF et deux autres à travers le pays y travaillaient.C'étaient presque tous des laboratoires qui avaient travaillé sur des plasmides bactériens. Les plasmides sont de petits cercles d'ADN, donc les laboratoires qui ont commencé étaient ceux qui étaient occupés à étudier de petits cercles d'ADN qui portent généralement des résistances aux médicaments entre les cellules.

Et c'est ce qui s'est passé pendant que j'étais post-doctorant.

Et quand je suis arrivé au MIT et en 1976, la technologie ne faisait que commencer.

J'ai été l'un des premiers laboratoires à essayer de découper des morceaux d'ADN et de les réunir. C'est donc un développement assez récent.

À ce stade, le séquençage de l'ADN n'avait pas été inventé.

L'idée que vous puissiez extraire un morceau d'ADN et en faire quelque chose ou produire une protéine n'était qu'une pensée. Cela n'existait pas.

Il est donc difficile d'insister sur l'importance de la découverte de ces enzymes de restriction. Maintenant, je veux juste vous dire d'où ils viennent, ou comment les gens les ont trouvés.

Et ils essaieront de le faire rapidement parce que je sais que certains d'entre vous s'impatientent avec l'histoire. Mais c'est vraiment important parce qu'il est très facile de se moquer de la recherche fondamentale. Vous pouvez ridiculiser n'importe quoi assez facilement, et vous pourriez simplement demander parce que je vous raconte l'histoire. Quelqu'un a proposé de le faire.

Je vais vous raconter l'expérience qui est fondamentalement la base de l'industrie biotechnologique, et auriez-vous été assez intelligent pour reconnaître qu'il s'agissait de la découverte d'un phénomène appelé restriction, restriction de la croissance des bactériophages sur les bactéries ?

Et c'était, voici en fait quelques EM et ces petits plasmides. Il s'agit d'une micrographie électronique.

Dans ces petits cercles, il a été ombragé. Et c'est en fait coloré artificiellement, mais c'était le genre de plasmides que les gens découpaient. Donc, comme je l'ai dit, essayer de passer à travers cet ADN, et tout ça, ce qui a rendu possible le séquençage au Whitehead Genome Center et tout ce dont je vais vous parler se passe. Je n'ai pas vraiment mis en place celui-ci.

Mais c'est Eric Lander qui enseigne le 701 à l'automne.

Je vous ai dit une photo de ce 50e ADN. Eh bien, ils ont organisé un banquet à la fin, et j'étais là.

C'est [Savandi Pabo ? d'Europe qui séquence le génome du chimpanzé. Et c'est Francis Collins qui est à la tête de l'ensemble du projet du génome humain. Voici Evelyn Witkin, qui a été une grande découvreuse des premiers événements de réparation de l'ADN.

Et j'ai mis celui-là parce que c'était plutôt intéressant.

Il y avait Eric, et Savandi, et Francis parlaient de ce qui se passerait quand ils connaîtraient la séquence du génome du chimpanzé, ce qui n'a pas été fait. Et il y avait une publicité, une affiche annonçant le dernier livre de Jim Watson. Et ils l'ont déchiré en deux et ont écrit des notes au dos tout au long du dîner.

Donc, si vous voulez voir à quoi ressemblent les scientifiques à la fine pointe, y compris quelqu'un qui enseigne le 701 l'automne quand ils n'enseignent pas le 701, il y a une image.

Donc de toute façon, la découverte des enzymes de restriction était Salvador Luria, que j'ai mentionné. Il était membre du département de biologie et l'un de nos lauréats du prix Nobel.

Il a commencé le centre de cancérologie. Il s'est aussi entraîné chez Jim Watson, quand je vous ai montré cette photo. C'est Salvador debout ici.

Une autre chose que Salvador a fait, il a été lauréat du prix Nobel mais il a pensé à la biologie d'introduction. Je suis donc essentiellement sur les traces de Salvador. Il a écrit un livre intitulé, même s'il était lauréat du prix Nobel, un livre intitulé 36 conférences d'introduction à la biologie. Et dans certaines universités, l'introduction à la biologie est enseignée par celui qui se trouve au bas de la chaîne alimentaire. Le professeur le plus jeune se retrouve coincé avec l'introduction à la biologie.

Et ici c'est l'inverse. Je veux dire que vous demandez à Eric et Bob, par exemple, Weinberg d'enseigner à l'automne, vous le dit.

Et vraiment d'où cela vient du fait que Salvador Luria avait un tel intérêt pour la réplication. Il s'est donc formé chez Jim Watson, a démarré le centre de cancérologie ici, et il a également réalisé ce phénomène de restriction. Et pour que ça marche avec un bactériophage. Et je connais un [couple qu'il a écrit?

, il n'aimait pas voir des vieux sous les porches. Alors j'ai paniqué, et j'ai pris cette photo suivante pour ce matin. Oh, je dois le montrer de toute façon pour deux raisons. Voici Salvador assis sur un porche à Cold Spring Harbor avec Max Delbrook qui a vraiment commencé une grande partie du travail sur les bactériophages qui nous a donné les fondements de la microbiologie. Et puis mettez-le en partie sur A parce qu'il montre l'informalité de la culture de la biologie moléculaire qui persiste à ce jour, et aussi parce que Salvador avait un sens de l'humour si espiègle. Vous auriez vraiment apprécié s'il avait enseigné ce cours. Quoi qu'il en soit, Salvador étudiait ce bactériophage. Tu te souviens qu'on en a parlé ?

Et ils fondamentalement [avec une seringue? ils ont injecté leur ADN dans la cellule. Il y a une micrographie électronique. L'ADN est là-haut.

Il entre, puis l'ADN s'empare de la cellule, la reprogramme et fait des babyphages. Et je t'ai montré comment on fait des plaques.

C'était donc ce qu'étudiait Salvador. Et c'est un peu ce dont on parle avec Mendel. Il n'avait pas beaucoup de techniques à sa disposition à l'époque. Il ne pouvait pas séquencer l'ADN.

Il ne pouvait pas faire beaucoup de choses. Mais il pourrait [plaque phage?

et compter, et des choses comme ça. Et ce que Salvador regardait, il avait un bactériophage, et il avait deux souches de bactéries.

Je les appellerai A et B. OK, voici l'expérience qui a fondé l'industrie biotechnologique. Êtes-vous prêt? Tu vas me financer ?

Très bien, donc ce que je propose de faire, c'est que je vais faire pousser le phage sur la souche A, et maintenant je vais plaquer sur la souche A et la souche B.

Je suis resté éveillé toute la semaine dernière en pensant à cette expérience.

Alors qu'est-ce que j'ai obtenu ? J'ai eu beaucoup de plaques sur la souche A, probablement quelque chose comme 109 ou 1010 par mil parce que c'est à quoi ressemble généralement ce lysat de phage une fois que vous les avez grandi.

Et si je les étale sur la souche B, pas de phage, peut-être un phage occasionnel. Donc, le bactériophage peut pousser le mien sur la souche A. Il ne peut pas pousser sur la souche B la plupart du temps, mais une variante a réussi à comprendre comment se développer sur la souche B. Donnez notre incursion dans la génétique, je pense que beaucoup d'entre vous penseraient, probablement comme je pense que Salvador l'a fait à l'époque, les choses ont muté. C'est appris. Il a fait quelques changements dans ses génomes qui lui ont permis de se développer sur la souche B. Donc, je me demande s'il a appris à se développer sur la souche B, ne pourrait-il pas se développer sur la souche A ? Donc, en gros, ce qu'il a pris était le phage de cette expérience, puis il les a étalés sur la souche A et la souche B. Et, comme vous pouvez le deviner, puisqu'il poussait sur la souche B, beaucoup de plaques, et il y avait beaucoup de plaques par ici. OK, donc il n'a pas oublié comment cultiver sur la souche A. Donc, mieux vaut vérifier ici aussi, besoin d'une expérience de contrôle, alors prenez ce type, étalez-le, souche A, souche B, quelques plaques ici.

Ce n'est pas une surprise pour la souche A.

Nous sommes de retour à l'endroit d'où nous avons commencé. Cela ne ressemble pas à un mutant, n'est-ce pas ? Et si c'était un mutant, tout le monde aurait dû être pareil.

Au lieu de cela, lorsque vous avez cultivé un phage sur la souche A, il n'avait pas la capacité de se développer sur la souche B. Mais si vous lui donniez une chance de se développer sur la souche B, la plupart d'entre eux n'y arriveraient pas.

Mais si c'était le cas, il avait maintenant acquis la capacité de se développer sur la souche B. Il pouvait donc encore se développer sur les deux.

Mais si vous prenez quelqu'un qui avait poussé, quelque chose avait poussé à la souche A, il l'a perdu. Et donc, il y avait alors l'idée que ce n'était pas une mutation. Quelque chose se passait dans la souche B qui lui a permis de pousser sur la souche B.

Et si jamais il s'éloignait de cet environnement, [il?

perdu. Ainsi, le phénomène a été appelé restriction.

Ce n'était pas une mutation. C'était autre chose.

Et il s'est avéré que cette restriction était due à une enzyme. Un exemple de ce genre de chose serait donc cette activité ECO-R1 qui est capable de couper à une séquence très spécifique. Maintenant, si vous voulez avoir un ensemble de ciseaux moléculaires à l'intérieur de vous qui pourraient couper une séquence G A T C, vous auriez un problème à moins que vous ne fassiez autre chose parce que chacune de vos séquences G A T C serait coupée par les enzymes de restriction.

Donc ce que les cellules qui ont une enzyme de restriction ont, comme une enzyme de modification qui reconnaît la même séquence, puis la modifie d'une manière qui la rend résistante à l'enzyme de restriction. Et dans le cas de l'ECO-R1, il met un groupe méthyle sur ce A. Vous auriez pu penser que cela interférerait avec l'appariement des bases, mais ce n'est pas le cas car l'adénine ressemble à ceci. Ce sont les gars qui font le raffinage des paires de bases, si vous regardez en arrière, et vous verrez que vous pourriez y mettre un groupe méthyle. Cela n'interférerait pas avec l'appariement de base, mais permettrait que cela se passe. Ainsi, c'était la découverte de ce phénomène de restriction de bactériophage qui se développait sur une souche, pas sur une autre. Il pourrait apprendre à pousser sur l'autre souche.

Il pourrait perdre cette acquisition. C'était ce phénomène. Les gens n'avaient pas d'autre raison que c'était un problème intéressant en biologie pour le comprendre. Une fois qu'ils en ont compris la base, un autre monde s'est ouvert parce que vous pouviez voir à partir des principes de base, maintenant je pouvais couper n'importe quel morceau d'ADN. Je pourrais générer ces petites extrémités collantes en surplomb. Je pourrais prendre un plasmide.

Les gens étaient au courant. J'ai pu en trouver un qui n'a qu'un seul site de restriction. Je pourrais mettre des choses dedans.

Maintenant, j'ai attaché une origine de réplication à chacune de ces pièces.

Et je suis en affaires. Je peux maintenant, pour la toute première fois, prendre un morceau d'ADN particulier et en faire autant de copies que je veux.

Et ce fut une transformation absolue de la façon dont les gens pouvaient penser à la biologie. Je vais donc juste vous donner une idée de la façon dont les gens commenceraient. Ainsi, la façon dont les gens ont commencé et a commencé la plupart des choses est qu'ils l'appellent, le terme habituel est que vous appelez la construction d'une bibliothèque d'ADN recombinant.

Et il existe différentes manières de procéder.

Mais ce principe est le même. Nous prendrions l'ADN de n'importe quel organisme qui vous intéresse, [et que vous étudiez ?].

Et nous coupons avec une enzyme de restriction. Et cette enzyme de restriction coupe partout où il y a des sites. Ils pourraient être proches l'un de l'autre. Ils sont peut-être éloignés l'un de l'autre. Mais quoi qu'il en soit, générez toujours un ensemble caractéristique de fragments. Et nous aurons maintenant, dans ce cas, le fragment numéro un, le fragment numéro deux, le fragment numéro trois, le fragment numéro quatre, et ainsi de suite. Et si c'est mon ADN, il y a beaucoup de fragments. Et bien sûr, ils sont tous mélangés.

Je ne peux pas dire où ils sont. Ils sont juste tous mélangés ensemble dans le tube à essai. Ensuite, nous prendrons ce vecteur que nous avons ouvert. Et maintenant, nous allons mélanger tous ces fragments avec ce vecteur. Et puis nous le rejoignons juste de la manière [que c'est coupé ? . Et maintenant ce que nous allons obtenir, c'est une collection de plasmides qui ont des inserts différents.

Ainsi, l'un des plasmides aura ce fragment numéro un.

Un autre d'entre eux aura le fragment numéro deux, numéro trois, et ainsi de suite. Ensuite, tout cela est ce qu'on appelle une bibliothèque. Vous pouvez voir si c'est de l'ADN de moi, il y avait 3 milliards de paires de bases pour commencer. Compte tenu de l'ADN humain, les séquences G A T C sont assez courantes. Vous pouvez calculer vous-même la fréquence du nombre de sites en moyenne qu'il y aurait pour une enzyme de restriction dans un morceau d'ADN et déterminer approximativement comment les fragments se trouveraient dans la bibliothèque d'ADN humain.

Donc, nous en sommes à mi-chemin. Nous pouvons maintenant faire une bibliothèque.

Nous pouvons le fabriquer à partir d'ADN bactérien. Nous pouvons le fabriquer à partir de l'ADN humain. Mais la prochaine chose que les gens devaient apprendre à faire était de trouver un fragment particulier qui avait le gène qui vous intéresse. Et il y a toute une variété de choses. Je veux dire, finalement aujourd'hui puisque le génome humain est séquencé, vous allez sur un ordinateur et un type et vous le trouvez parce que la séquence est connue. Mais la seule raison pour laquelle nous pouvons le faire est à cause de tout le travail qui a été fait entre les deux.

Alors, je vais vous donner plusieurs façons de le faire. Mais l'une des façons dont je pense que vous pouvez voir très facilement, et cela revient en fait au terme complémentation. Vous vous souvenez de la complémentation ?

Nous avions quelque chose qui était mutant, puis nous avions introduit un gène de type sauvage et l'avions à nouveau corrigé. Ainsi, par exemple, supposons que j'étudie la biosynthèse de l'histidine chez E.

coli, et je voulais trouver le gène qui encodait l'enzyme que je venais de désactiver dans mon mutant histidine moins. Donc, si j'ai un [hisoxotrophe ?], je l'appellerai un [son G ?

gène, par exemple, c'est l'un des gènes impliqués dans la fabrication de l'histidine. Donc, comme c'est un auxotrophe de l'histidine, si je l'ai sur des plaques de glucose minimales et que je le raye, il ne va pas grandir. Mais si je le cultive avec un minimum de glucose et d'histidine, alors il pourra se développer, n'est-ce pas ? Donc, j'ai une variante de cet organisme.

Il contient une seule mutation qui affecte un gène.

Et parce que je n'ai pas ce gène, je ne peux pas grandir avec le minimum.

Si je créais une bibliothèque d'ADN d'E. coli, qui contiendrait également beaucoup de fragments, et que je prenais cette bibliothèque et que je la mettais dans ce mutant, je vais avoir un gros gâchis de choses, tous les différents plasmides avec tous les différents fragments qui entrent dans ce mutant. Comment vais-je trouver celui que je veux ? Quelqu'un voit ça ? Ce n'est pas si dur. Je suis le mutant.

Je ne peux pas grandir avec un minimum parce que je ne peux pas fabriquer cette enzyme.

Par conséquent, je ne peux pas faire d'histidine. De quoi ai-je besoin? Comment pourrais-tu me soigner si tu étais médecin ? Quel est le gène que nous voulons sortir d'ici ?

Celui qui fabrique cette enzyme particulière qui fabrique l'histidine.

Ouais, prends toute la bibliothèque, mets-la dans ce mutant. Si le gène entrant code pour l'ADN polymérase, je ne vais pas aider ce type. Il ne se développera toujours pas en minime, prendre un gène impliqué dans la fabrication d'une partie de la paroi cellulaire aiderait.

Mais si je mets le, j'obtiens un fragment d'ADN qui inclut le gène G plus de son, et je le mets ici, il va grandir. S'il a le plasmide qui a, ou disons le vecteur qui a le gène his G plus.

Donc, ce que vous avez fait, c'est vraiment, en quelque sorte, vous avez utilisé ce principe de complémentation que certains d'entre vous se demandaient en quelque sorte lorsque nous faisions de la génétique. Donc, vous briseriez une copie d'un gène.

Dans les choses dont nous avons parlé, nous apportons un chromosome entier qui n'incluait qu'une copie de type sauvage du gène. Avec l'ADN recombinant, nous pouvons vraiment le réduire à l'extrême. Nous pouvons apporter un morceau d'ADN qui n'est que le gène qui est cassé.

Et nous pouvons ramener le gène au type sauvage. Une chose, juste pour terminer, vous verrez, si vous vous souvenez quand j'ai parlé de langages qui ne sont pas universels, bien que le code génétique soit universel, les promoteurs et autres ne le sont pas. Donc je ne pourrais jamais faire ça avec un ADN humain, n'est-ce pas, parce qu'il ne serait pas exprimé. Nous avons donc besoin d'autres moyens de les trouver. Nous en parlerons lors de la prochaine conférence, d'accord ?


ADN recombiné : compréhension de la 9e année pour la biologie de l'IGCSE 5.12 5.13 5.14

Dans le dernier article sur ce sujet, j'ai expliqué les deux types d'enzymes nécessaires à la modification génétique des organismes :

Les enzymes de restriction qui peut découper des molécules d'ADN à des séquences cibles spécifiques, entraînant souvent des fragments avec des extrémités collantes

ADN ligase qui réunit des fragments pour former une seule molécule d'ADN

Le programme EdExcel iGCSE utilise l'exemple de la modification génétique des bactéries pour produire de l'insuline humaine. L'insuline humaine est une hormone qui aide à réguler la concentration de glucose dans le sang. Il est fabriqué dans le pancréas lorsque la concentration de glucose dans le sang devient trop élevée et que les cellules hépatiques absorbent le glucose du sang et le convertissent en glycogène, une molécule de stockage. Les patients atteints de diabète de type I ne peuvent pas fabriquer leur propre insuline et doivent donc l'injecter plusieurs fois par jour après les repas pour s'assurer qu'ils maintiennent une concentration saine et constante de glucose dans leur sang.

Les bactéries peuvent être génétiquement modifiées pour produire de l'insuline humaine. Ces bactéries transgéniques peuvent être cultivées en fermenteur et l'insuline produite peut être extraite, purifiée et vendue.

Comment mettre la main sur le gène de l'insuline humaine ?

Eh bien, la réponse honnête est qu'il existe une variété de façons d'y parvenir. Il peut maintenant être synthétisé artificiellement car nous connaissons la séquence de bases exacte du gène, mais il peut également être coupé d'une banque d'ADN humain à l'aide d'une enzyme de restriction. Il existe également d'autres moyens, mais par souci de concision (et de santé mentale), je ne vais pas les aborder ici. [Si cela vous intéresse vraiment, découvrez comment la transcription inverse de l'ARN messager à partir des cellules du pancréas peut vous permettre de construire le gène de l'insuline.]

Comment faire entrer le gène de l'insuline humaine dans une bactérie ?

Rappelez-vous que les cellules bactériennes sont fondamentalement différentes des cellules animales et végétales. Une différence est que les cellules bactériennes n'ont pas de noyau et que leur ADN se présente sous la forme d'un anneau qui flotte dans le cytoplasme. De nombreuses bactéries ont également des plasmides qui sont de petits anneaux supplémentaires d'ADN et ceux-ci fournissent un moyen d'introduire un nouveau gène dans une bactérie.

Les bactéries échangent des plasmides dans un processus appelé conjugaison et il est donc assez facile d'extraire le plasmide de la bactérie. Si le plasmide est ouvert à l'aide du même enzyme de restriction telle qu'elle a été utilisée pour couper le gène de l'insuline humaine, les extrémités collantes correspondront et ainsi l'ADN ligase rejoindra les deux morceaux d'ADN pour former un plasmide recombinant. Le diagramme ci-dessous montre le processus de l'hormone de croissance humaine, mais ce serait exactement le même pour l'exemple que nous examinons.

Si les plasmides recombinants sont insérés dans des bactéries, les bactéries lisent le gène de l'insuline humaine et produisent ainsi la protéine insuline.

Comment cultiver les bactéries transgéniques à l'échelle industrielle ?

Les bactéries qui ont absorbé le plasmide recombinant sont cultivées dans un fermenteur. Il s'agit d'une grande cuve en inox (facile à nettoyer et à stériliser) qui présente souvent plusieurs caractéristiques de conception conservées entre les différentes variétés :

Le fermenteur a généralement un Veste de refroidissement pour évacuer l'excès de chaleur. La veste a souvent un tuyau d'entrée d'eau froide et l'eau plus chaude est emportée. Il doit y avoir un mécanisme pour mélange le contenu du fermenteur de sorte que le schéma ci-dessus montre des palettes attachées à un moteur. Les fermenteurs ont aussi besoin d'un entrée stérile système permettant d'amener de l'air, de l'eau et des nutriments dans le fermenteur mais sans introduire de bactéries et de champignons étrangers. L'air est nécessaire car les bactéries sont aérobies et ont besoin d'oxygène pour respirer.

Si les bactéries dans le fermenteur contiennent le gène de l'insuline humaine, elles seront alors capables de produire de l'insuline humaine. Celui-ci peut être extrait, purifié et vendu au NHS pour le traitement des diabétiques de type I.


Restriction d'ADN

La découverte d'enzymes capables de couper et coller l'ADN a rendu possible le génie génétique. Les enzymes de restriction, présentes naturellement dans les bactéries, peuvent être utilisées pour couper des fragments d'ADN à des séquences spécifiques, tandis qu'une autre enzyme, l'ADN ligase, peut attacher ou rejoindre des fragments d'ADN avec des extrémités complémentaires.

Cette animation est également disponible en VIDEO .

La découverte d'enzymes capables de couper et coller l'ADN a rendu possible le génie génétique. Les enzymes de restriction, présentes naturellement dans les bactéries, peuvent être utilisées pour couper des fragments d'ADN à des séquences spécifiques, tandis qu'une autre enzyme, l'ADN ligase, peut attacher ou rejoindre des fragments d'ADN avec des extrémités complémentaires.

adn ligase, fragments d'adn, enzymes de restriction, génie génétique, bactéries, séquences, découverte


Que se passe-t-il si nous injectons une enzyme de restriction dans le sang - Biologie

Es-tu sûr?

Cette action ne peut pas être annulée. Cela supprimera définitivement toutes les questions pratiques.

Es-tu sûr?

Cette action ne peut pas être annulée. Cela supprimera définitivement toutes les questions pratiques.

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

Ajouter une note
Ajouter une note
Ajouter une note

(1) B est l'enfant de A et C.

(2) C est l'enfant de A et B.

(3) D est l'enfant de B et C.

(4) A est l'enfant de B et C.

Ajouter une note
Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

L'extrait de streptocoque de forme S tué par la chaleur traité avec des protéases est mélangé avec des cellules vivantes de streptocoque de forme R et injecté à des souris vivantes. Qu'est-ce qui est le plus susceptible de se produire?
1. Les souris vivraient.
2. Les souris mourraient.
3. Le sang de souris aurait des cellules R mortes
4. Une nouvelle souche de Streptococcus sera présente chez la souris.

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

L'ajout de désoxyribonucléotides par l'ADN polymérase lors de la synthèse d'ADN est un processus endergonique. La source d'énergie utilisée est :
1. ATP.
2. L'énergie des photons de la lumière.
3. Entropie créée à partir de la digestion des protéines.
4. Les nucléotides eux-mêmes

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

On pense que tous les organismes sont issus d'un seul ancêtre lointain. La preuve la plus solide pour cela serait :
1. L'ADN stocke l'information génétique dans tous les organismes.
2. Le code génétique est universellement un code triplet.
3. Les acides aminés spécifiés par des triplets particuliers sont presque toujours identiques entre deux organismes.
4. Le code génétique est dégénéré mais sans ambiguïté.


ADN recombiné : compréhension de la 9e année pour la biologie de l'IGCSE 5.12 5.13 5.14

Dans le dernier article sur ce sujet, j'ai expliqué les deux types d'enzymes nécessaires à la modification génétique des organismes :

Les enzymes de restriction qui peut découper des molécules d'ADN à des séquences cibles spécifiques, entraînant souvent des fragments avec des extrémités collantes

ADN ligase qui réunit des fragments pour former une seule molécule d'ADN

Le programme EdExcel iGCSE utilise l'exemple de la modification génétique des bactéries pour produire de l'insuline humaine. L'insuline humaine est une hormone qui aide à réguler la concentration de glucose dans le sang. Il est fabriqué dans le pancréas lorsque la concentration de glucose dans le sang devient trop élevée et que les cellules hépatiques absorbent le glucose du sang et le convertissent en glycogène, une molécule de stockage. Les patients atteints de diabète de type I ne peuvent pas fabriquer leur propre insuline et doivent donc l'injecter plusieurs fois par jour après les repas pour s'assurer qu'ils maintiennent une concentration saine et constante de glucose dans leur sang.

Les bactéries peuvent être génétiquement modifiées pour produire de l'insuline humaine. Ces bactéries transgéniques peuvent être cultivées en fermenteur et l'insuline produite peut être extraite, purifiée et vendue.

Comment mettre la main sur le gène de l'insuline humaine ?

Eh bien, la réponse honnête est qu'il existe une variété de façons d'y parvenir. Il peut maintenant être synthétisé artificiellement car nous connaissons la séquence de bases exacte du gène, mais il peut également être coupé d'une banque d'ADN humain à l'aide d'une enzyme de restriction. Il existe également d'autres moyens, mais par souci de concision (et de santé mentale), je ne vais pas les aborder ici. [Si cela vous intéresse vraiment, découvrez comment la transcription inverse de l'ARN messager à partir des cellules du pancréas peut vous permettre de construire le gène de l'insuline.]

Comment faire entrer le gène de l'insuline humaine dans une bactérie ?

Rappelez-vous que les cellules bactériennes sont fondamentalement différentes des cellules animales et végétales. Une différence est que les cellules bactériennes n'ont pas de noyau et que leur ADN se présente sous la forme d'un anneau qui flotte dans le cytoplasme. De nombreuses bactéries ont également des plasmides qui sont de petits anneaux supplémentaires d'ADN et ceux-ci fournissent un moyen d'introduire un nouveau gène dans une bactérie.

Les bactéries échangent des plasmides dans un processus appelé conjugaison et il est donc assez facile d'extraire le plasmide de la bactérie. Si le plasmide est ouvert à l'aide du même enzyme de restriction telle qu'elle a été utilisée pour couper le gène de l'insuline humaine, les extrémités collantes correspondront et ainsi l'ADN ligase rejoindra les deux morceaux d'ADN pour former un plasmide recombinant. Le diagramme ci-dessous montre le processus de l'hormone de croissance humaine, mais ce serait exactement le même pour l'exemple que nous examinons.

Si les plasmides recombinants sont insérés dans des bactéries, les bactéries lisent le gène de l'insuline humaine et produisent ainsi la protéine insuline.

Comment cultiver les bactéries transgéniques à l'échelle industrielle ?

Les bactéries qui ont absorbé le plasmide recombinant sont cultivées dans un fermenteur. Il s'agit d'une grande cuve en inox (facile à nettoyer et à stériliser) qui présente souvent plusieurs caractéristiques de conception conservées entre les différentes variétés :

Le fermenteur a généralement un Veste de refroidissement pour évacuer l'excès de chaleur. La veste a souvent un tuyau d'entrée d'eau froide et l'eau plus chaude est emportée. Il doit y avoir un mécanisme pour mélange le contenu du fermenteur de sorte que le schéma ci-dessus montre des palettes attachées à un moteur. Les fermenteurs ont aussi besoin d'un entrée stérile système permettant d'amener de l'air, de l'eau et des nutriments dans le fermenteur mais sans introduire de bactéries et de champignons étrangers. L'air est nécessaire car les bactéries sont aérobies et ont besoin d'oxygène pour respirer.

Si les bactéries dans le fermenteur contiennent le gène de l'insuline humaine, elles seront alors capables de produire de l'insuline humaine. Celui-ci peut être extrait, purifié et vendu au NHS pour le traitement des diabétiques de type I.


Information supplémentaire

Ce fichier contient des figures supplémentaires 1-11, un tableau supplémentaire 1 et des légendes pour les films supplémentaires 1-3. (PDF 1937 ko)

Film supplémentaire 1

Ce film montre le mouvement des globules rouges dans les vaisseaux sanguins d'embryons de type sauvage. (MOV 707 ko)

Film supplémentaire 2

Ce film montre le mouvement des globules rouges à travers les vaisseaux sanguins dans des embryons ayant reçu une injection de cdh5 MO. (MOV 1831 ko)

Film supplémentaire 3

Ce film montre le mouvement des globules rouges à travers les vaisseaux sanguins dans des embryons ayant reçu une injection de cdh5 GoldyTALEN. (MOV 89 ko)


Que se passe-t-il si nous injectons une enzyme de restriction dans le sang - Biologie

Es-tu sûr?

Cette action ne peut pas être annulée. Cela supprimera définitivement toutes les questions pratiques.

Es-tu sûr?

Cette action ne peut pas être annulée. Cela supprimera définitivement toutes les questions pratiques.

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

Ajouter une note
Ajouter une note
Ajouter une note

(1) B est l'enfant de A et C.

(2) C est l'enfant de A et B.

(3) D est l'enfant de B et C.

(4) A est l'enfant de B et C.

Ajouter une note
Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

L'extrait de streptocoque de forme S tué par la chaleur traité avec des protéases est mélangé avec des cellules vivantes de streptocoque de forme R et injecté à des souris vivantes. Qu'est-ce qui est le plus susceptible de se produire?
1. Les souris vivraient.
2. Les souris mourraient.
3. Le sang des souris aurait des cellules R mortes
4. Une nouvelle souche de Streptococcus sera présente chez la souris.

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

L'ajout de désoxyribonucléotides par l'ADN polymérase lors de la synthèse d'ADN est un processus endergonique. La source d'énergie utilisée est :
1. ATP.
2. L'énergie des photons de la lumière.
3. Entropie créée à partir de la digestion des protéines.
4. Les nucléotides eux-mêmes

Ajouter une note

Pour débloquer toutes les explications des 38 chapitres, vous devez être inscrit au cours MasterClass.

JE VOUDRAIS EN SAVOIR PLUS

On pense que tous les organismes sont issus d'un seul ancêtre lointain. La preuve la plus solide pour cela serait :
1. L'ADN stocke l'information génétique dans tous les organismes.
2. Le code génétique est universellement un code triplet.
3. Les acides aminés spécifiés par des triplets particuliers sont presque toujours identiques entre deux organismes.
4. Le code génétique est dégénéré mais sans ambiguïté.


TEXTE INTERNET DE MICROBIOLOGIE 101

Quels sont les OUTILS DE BASE de GE, comment sont-ils et comment ils fonctionnent.

Comment s'effectue le CLONAGE DE GENE.

Comment l'ADN peut être utilisé pour IDENTIFIER tous les organismes vivants

Comment pouvons-nous détecter de très petites quantités d'ADN même lorsqu'elles peuvent avoir des millions d'années.

De plus, les problèmes ÉTHIQUES de la révolution GE seront présentés et quelques manières possibles de les traiter seront envisagées.

DESCRIPTION DE LA BIOLOGIE MOLÉCULAIRE

J'ai énuméré certains des changements que vous pourriez connaître au cours de votre vie, voire certains au cours des prochaines années. Avec le séquençage du GÉNOME HUMAIN ENTIER prévu au tournant du siècle, un tout nouvel ensemble de possibilités sera débloqué. Actuellement (automne 1996), nous avons séquencé >10 000 des

100 000 gènes humains, et le taux de séquençage s'accélère à mesure que les techniques de séquençage s'améliorent. Environ 3 000 maladies génétiques humaines sont actuellement connues. Cela signifie qu'environ 14 % des nouveau-nés sont atteints d'une maladie génétique « visible ». Cela ne commence pas à inclure les « tendances » génétiques (à développer le cancer, l'arthrite, la tuberculose, le rhume, l'asthme, la grippe, etc.) et/ou les « conditions » que nous avons tous. Quelles conditions génétiques avez-vous ? Par exemple, mon demi-frère et moi souffrons d'une maladie génétique appelée Sprue coeliaque, ce qui signifie que la protéine de blé (gluten) fait du mal aux cellules de notre intestin et nous ne pouvons pas manger de pizza, etc. Cependant, nous allons BIEN tant que car nous ne mangeons pas de produits à base de blé. Sprue est une "condition" génétique courante qui affecte jusqu'à 25% des Irlandais et un nombre moindre d'autres groupes ethniques. Combien de lecteurs sont irlandais ? Certains d'entre vous souffrent d'allergies, de myopie, de migraines, etc., qui ont tous leur origine dans votre génome. Une fois le génome humain cartographié, nous pourrons non seulement identifier les allèles particuliers que chacun de nous possède, mais nous finirons par trouver un moyen de remplacer les « gènes indésirables » par de « bons gènes ».

QUESTION DE RÉFLEXION CRITIQUE : Comment définissons-nous, en tant qu'individus et en tant que société, les gènes « bons et mauvais » ? Par exemple, s'il s'avère que les gènes sont à la base de l'alcoolisme ou de l'homosexualité ou de la pédophilie ou de la maniaco-dépression, allons-nous « guérir » les gens de ces gènes ? Si un gène « homosexuel » est trouvé, que feriez-vous si vous découvriez qu'un de vos fœtus était porteur de ce gène ?

Un problème actuel avec la révolution génétique est que savoir quel gène provoque une maladie et être capable d'identifier la présence de ce gène chez une personne, ne signifie pas que nous COMPRENONS la biologie moléculaire du processus de la maladie, donc nous NE POUVONS généralement PAS PRÉVENIR ou GUÉRIR la maladie causée par un gène défectueux. Un exemple de ce DILEMME TERRIBLE est qu'un certain nombre de gènes qui prédisposent les femmes au cancer du sein ont été découverts (et de nouveaux sont continuellement découverts). Cela soulève d'importantes considérations éthiques et personnelles.

Si une GUÉRISON ou une PRÉVENTION n'est pas possible, doit-on dire à une femme qu'elle est porteuse d'un tel gène ?

Si un remède ou une prévention n'est PAS POSSIBLE, voudriez-vous savoir que vous aviez une bombe à retardement en vous ?

  • Examinons une autre situation de "zone grise" avant de continuer. La maniaco-dépression (MD) est une maladie qui frappe de nombreuses personnes. Dans certains, il est relativement bénin tandis que dans d'autres, il fait des ravages terribles, conduisant souvent au SUICIDE. Il semble également avoir une base génétique car il est familial et stigmatise souvent les membres affectés et non affectés. Je parierais de l'argent que la plupart d'entre vous qui lisez ceci connaissent quelqu'un qui est maniaco-dépressif et, bien sûr, certains d'entre vous sont docteurs en médecine. Pourtant, la maladie est souvent traitable par des médicaments peu coûteux et une psychothérapie, bien que de nombreuses personnes souffrent de tourments pendant des années avant d'être correctement diagnostiquées et traitées. Un côté intéressant de MD est que de nombreux artistes créatifs et politiciens ont été (peut-être certains de nos politiciens actuels sont MD) MD. Robert Schumann, Lord Byron, Vincent van Gogh, Winston Churchill et Alfred, Lord Tennyson ont tous souffert des symptômes classiques du MD (voir « Maladie maniaco-dépressive et créativité », Sci. Am. Feb. 1995 & Nov. 1995). Une fois que nous avons identifié les gènes à l'origine de la MD, nous pouvons utiliser ces informations pour décider s'il faut avoir des enfants porteurs du gène MD ou avorter tout fœtus porteur de ce gène. Que feriez-vous? Finalement, nous serons en mesure de guérir complètement (réprimer) la maladie. La ramification de ces découvertes rendra-t-elle le monde moins intéressant et moins stimulant ? Quel est ton opinion?

Est-ce que son compagnon, son patron, sa compagnie d'assurance, son employeur potentiel, etc. devraient avoir accès à vos informations génétiques ? Pouvez-vous penser à des situations où il serait logique et raisonnable que d'autres aient cette information ? Et l'armée ? La CIA ?

Si vous possédiez une compagnie d'assurance-vie, donneriez-vous vos dons politiques à un membre du Congrès qui préférerait exiger des assurés potentiels qu'ils donnent ces informations à leur compagnie d'assurance.

Qui paie pour le dépistage des gènes de la maladie, dont le coût est actuellement élevé ? Dois-je payer pour votre projection et vice versa ?

Et si vous contrôliez l'information génétique et que vous savez que la donner conduira à un avortement, que feriez-vous ?

Que se passe-t-il si vous avez accès aux informations génétiques d'une personne que votre fille/fils, sœur/frère, etc. va épouser et que vous ne pensez pas qu'elle leur a parlé d'une "maladie" génétique grave. Diriez-vous ? A qui appartient votre fidélité ? Qu'est-ce qui est éthique ici ?

Un dernier rappel à tous ceux qui envisagent d'éviter ces problèmes. Les essais de thérapie génique sont actuellement en cours (mais ils ont des problèmes de fonctionnement : TIME 10/9/95 Science 269:1050 [1995]), les gens décident d'avorter sur la base de les résultats des tests génétiques fœtaux et le nombre de gènes défectueux identifiés augmentent presque quotidiennement (et certains de ceux qu'ils trouveront seront ceux que vous et moi portons).

HISTOIRE DU GÉNIE GÉNÉTIQUE

Dans les années 1950, il avait été noté que si l'on cultivait un bactériophage particulier sur une souche hôte mutante bactérienne particulière ( A ), puis infectait une souche mutante bactérienne ( B ), de la même espèce, avec le phage A , le rendement en phage de la souche B était TRÈS FAIBLE. Cependant, si vous preniez les quelques phages B produits et infectiez la souche B avec eux, le rendement en phages était maintenant NORMAL. Par la suite, dans les années 1960, on a découvert que l'ADN du phage qui poussait sur la souche B avait été CHIMIQUEMENT MODIFIÉ de sorte qu'il ne pouvait pas être clivé (détruit) par une DNase dans la souche B . La DNase impliquée dans ce clivage s'est avérée quelque peu spécifique, en ce sens qu'elle coupait principalement l'ADN à CERTAINES SÉQUENCES à moins que ces séquences n'aient été CHIMIQUEMENT MODIFIÉES par des enzymes dans la cellule (manquante dans la souche A). Toutes les DNases précédentes coupaient l'ADN au hasard, donc cette découverte suggérait que l'ADN pouvait être découpé en FRAGMENTS SPÉCIFIQUES qui contiendraient TOUJOURS le MÊME ENSEMBLE DE GÈNES entre les sites de coupure. Cependant, ces premières DNases « spécifiques » ne se sont pas révélées aussi SPÉCIFIQUES qu'espéré. Enfin, en 1970, Hamilton Smith a accidentellement découvert qu'une DNase de la bactérie Haemophilus influenzae COUPE l'ADN UNIQUEMENT DANS DES SEQUENCES D'ADN UNIQUES connues sous le nom de SITES PALINDROMIQUES.

PALINDROMES

Dans l'ADN, un SITE PALINDROMIQUE est une SÉQUENCE DE PAIRES DE BASE dans un ADN double brin qui lit la même chose en arrière et en avant à travers le double brin. Par exemple, la séquence de paires de bases GAATTC est un palindrome car les deux séquences du double brin LIRE LA MÊME lorsqu'elles sont lues à partir de leurs extrémités respectives "G" ou "C" (brin COMPLEMENTAIRE = CTTAAG). Les enzymes qui coupent ces sites spécifiques sont appelées ENZYMES DE RESTRICTION (RE). En fonction des TYPES DE COUPES qu'ils font, il existe deux types de RE :

Un groupe coupe directement l'ADN double brin, produisant de l'ADN BLUNT ENDED (Fig. 2).

Un autre type coupe le brin d'ADN HORS DU CENTRE des sites palindromiques, mais entre les MÊMES DEUX BASES sur les brins opposés. Cela laisse une ou plusieurs bases en surplomb sur chaque brin et de telles extrémités sont appelées EXTRÉMITÉS STICKY (Fig. 1) car elles forment des LIENS HYDROGÈNES avec leurs homologues coupés complémentaires.

Par exemple, dans la séquence de bases G A ATTC, le RE qui coupe ce site clive l'ADN entre le " G " et le " A " sur chaque brin complémentaire, laissant ainsi les surplombs de AATT & TTAA respectivement (Fig. 1). Plus de 200 RE différents ont été isolés qui coupent à de nombreuses séquences d'ADN spécifiques différentes. Ils sont tous ASSEZ SPECIFIQUES et cette spécificité est la CLE de leur utilisation. Des ER qui coupent à 4, 5, 6, 8, 9 et 11 sites palindromiques de paires de bases ont été trouvés. Il s'ensuit que plus les PAIRES DE BASE dans le site palindromique sont les MOINS PROBABLES qu'un site existe statistiquement. C'est-à-dire qu'un RE coupant à 4 bases coupe le même ADN beaucoup plus de fois qu'un coupeur à 8 bases. Les sites de coupe impairs ne sont pas de vrais palindromes d'ADN, dans la mesure où la pb centrale se lit différemment dans les deux sens. Par exemple AA?TT est un site de coupe de 5 pb, où le ? = un certain nombre de bases différentes.

Figure 1. Coupe à extrémités collantes avec enzyme de restriction. Les flèches rouges indiquent les positions où le RE coupe l'ADN. Lorsque les supports complémentaires s'écartent, les surplombs "collants" sont laissés.

Figure 2. Coupes à extrémités franches par une enzyme de restriction. Les RE coupant des extrémités franches clivent l'ADN entre deux bases au milieu d'un site palindromique.

QUESTION DE RÉFLEXION CRITIQUE : Voici des exemples de sites d'ADN RE sur un seul brin. Ajoutez les bases complémentaires et trouvez les sites RE : CCTAGT AATCCTAGGACG AAATTAATCGG TAAGGGCGCGCCTAAT TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGTATCCCCGGGTACCGAGCTCGAATTCACT.

Il y a 10 sites RE dans ce dernier, pouvez-vous trouver les dix ?

Le dernier composant important du génie génétique est une enzyme appelée LIGASE. La ligase est une enzyme qui relie de manière covalente le squelette sucre-phosphate des bases. La ligase est également impliquée dans la réplication de l'ADN. En effet, la LIGASE inverse l'action de la RE, qui rompt les liaisons squelette sucre-phosphate. La ligase a besoin d'énergie pour former ces liaisons (Fig. 3). La ligase rejoindra soit les extrémités "collantes" soit les extrémités "émoussées", mais elle est plus efficace pour fermer les extrémités collantes car les "surplombs collants" de ces extrémités ajoutent de la stabilité qui maintient les supports ensemble pendant que la ligase fonctionne, tandis que les extrémités émoussées sont MOINS STABLE. Les extrémités collantes doivent avoir le MÊME « surplomb de base » (Fig. 1), mais N'IMPORTE QUELLE EXTRÉMITÉ ÉTONNÉE peut être jointe à n'importe quelle autre extrémité émoussée (Fig. 2).

Figure 3. La réaction de la ligase. Les extrémités collantes de deux brins d'ADN s'alignent en fonction de leur liaison hydrogène pb. Les sites de coupe sont indiqués par les flèches bleues. La ligase se lie aux brins d'ADN à liaison hydrogène et forme des liaisons covalentes entre les deux extrémités de l'ADN (liaisons rouges), les joignant ainsi. De même, si les extrémités franches de l'ADN se rejoignent, la ligase peut former des liaisons covalentes entre elles.

Revue des composants de GE :

(1) L'ADN double brin contient des sites d'enzyme de restriction palindromique.

(2) De nombreux types d'enzymes de restriction coupent ou clivent les sites palindromiques dans l'échantillon d'ADN double brin formant une extrémité collante ou émoussée.

(3) L'enzyme ligase et une source d'énergie fusionnent ou joignent ensemble deux extrémités collantes ou deux extrémités franches d'ADN.

LES ÉTAPES DU GÉNIE GÉNÉTIQUE

Isoler l'ADN SOURCE et VECTEUR. Les ADN doivent être relativement exempts de matières contaminantes qui interfèrent avec les étapes enzymatiques ultérieures.

Les ADN source et vecteur sont coupés avec RESTRICTION ENZYMES . Lorsque des extrémités collantes sont formées, l'ADN est coupé avec la ou les mêmes enzymes de restriction, mais les RE qui produisent des extrémités franches fonctionnent également bien dans le clonage.

Les ADN vecteur et source sont mélangés avec un SYSTÈME LIGASE et se lient de manière covalente.

Enfin, l'ADN LIGÉ est TRANSFORMÉ en une cellule hôte. Habituellement, la cellule hôte est une bactérie COMPÉTENTE, mais de plus en plus de cellules eucaryotes sont utilisées. Après qu'une croissance appropriée s'est produite, les cellules hôtes sont examinées pour la PRÉSENCE de la source ou de l'ADN CLONÉ dans son cytoplasme.

L'ensemble du processus de clonage prend souvent MOINS D'UN JOUR et est réalisé en utilisant des volumes de 1 000 microlitres ou moins. L'examen de l'hôte transformé pour le gène d'intérêt peut prendre environ un jour de plus. Un gène qui a été transféré avec succès de cette manière aurait été CLONÉ . Le processus est appelé " CLONAGE ", " TECHNOLOGIE DE L'ADN RECOMBINANT " ou " ADN RECOMBINANT ". Ces étapes sont résumées dans la figure 4 ci-dessous.

Figure 4. Clonage. Pour une autre figure illustrant le clonage, cliquez ici et consultez la figure 11a.

UTILISATIONS DE L'ADN CLONÉ.

SÉQUENCAGE : Le séquençage détermine la séquence de paires de bases d'un gène. En lisant le code à 3 lettres, le séquençage décrit également la SÉQUENCE D'ACIDES AMINÉS traduite à partir de ce gène.

MUTATION : La séquence du gène bp peut être modifiée de manière spécifique et le gène modifié peut être réinséré dans son hôte d'origine pour voir ce que fait chaque mutation spécifique. Alors que la mutation spontanée est aléatoire, il existe désormais des techniques permettant de CHANGER n'importe quel codon d'un gène en n'importe quel autre codon. Par conséquent, il est possible d'étudier les effets de SINGLE AMINO ACID CHANGES sur la fonction du produit génique, qui est, après tout, le but ultime de l'exercice.

Remplacer une forme mutée du gène dans la cellule hôte d'origine par une forme saine du gène pour voir exactement ce qu'il fait dans son lieu de résidence prévu.

Utiliser le gène amplifié pour fabriquer des QUANTITÉS ÉNORMES du PRODUIT GÉNIQUE à des fins commerciales. C'est ainsi que des produits comme l'insuline humaine, l'hormone de croissance humaine, l'activateur du plasminogène, les interlukines et l'hormone du lait bovin sont tous fabriqués.

INSÉRER le gène dans UNE AUTRE ESPÈCE dans un but précis. De tels animaux ou plantes sont dits TRANSGÉNIQUES. Par exemple, de nombreuses cultures sont protégées contre les larves de chenilles parce qu'un gène d'une bactérie a été inséré dans leurs cellules. Ce gène produit une protéine qui est HAUTEMENT, et SPÉCIFIQUEMENT, TOXIQUE pour les larves de nombreux mites et papillons qui attaquent les cultures vivrières.

ORGANISMES TRANSGÉNIQUES

Il y a un DOWN SIDE de GE. Les mêmes procédures qui peuvent être utilisées pour produire une meilleure récolte, ou de l'insuline humaine, peuvent également être utilisées pour fabriquer un PATHOGÈNE plus PUISSANT. Il est prouvé que certains pays l'ont fait ou envisagent de le faire. Par exemple, l'Irak cultivait apparemment des agents pathogènes bactériens pour la guerre biologique, mais il a été dissuadé de les utiliser lorsque nous avons menacé de représailles atomiques. Ce n'est qu'un petit saut dans le « raisonnement » d'envisager de concevoir un « meilleur agent pathogène » avec lequel détruire un ennemi détesté (remplissez le blanc - le rapport de presse que certains Américains considèrent comme l'ennemi toute personne travaillant pour le gouvernement). Pour plus d'informations, lisez " Les spectres des armes biologiques " Scientific Am. Déc. 1996, p. 60.

Figure 5. Utilisation du clonage de gènes pour amplifier l'ADN cloné et/ou pour produire des lots du produit du gène cloné.

QUESTION DE RÉFLEXION CRITIQUE : Que devrions-nous faire pour réglementer les plantes et les animaux génétiquement modifiés ? Devrions-nous exiger qu'ils soient testés pour la sécurité, qu'ils soient étiquetés comme GE ? Pouvez-vous penser à d'autres considérations concernant ces « produits » ? Mangerez-vous des « aliments génétiquement modifiés » ?

EMPREINTE GÉNÉTIQUE

Les TROIS principes de base nécessaires à la compréhension des empreintes génétiques et tout ce qui en découle vous les connaissez déjà (le principe de la liaison ligand/récepteur voir fig.2 chap 7 ), mais cela vaut la peine de prendre un moment pour les passer en revue.

L'APPARIEMENT DE BASE de AT (AU) & GC est le PRINCIPE DE BASE de cette procédure. Si vous comprenez cela, tout le reste se met facilement en place.

La SPÉCIFICITÉ de l'activité enzymatique est le deuxième principe CRUCIAL pour comprendre les empreintes génétiques de l'ADN. Il s'agit de la coupure de l'ADN par des ENZYMES DE RESTRICTION spécifiques au niveau de séquences palindromiques UNIQUES.

La reconnaissance qu'un CHANGEMENT dans une SEULE PAIRE DE BASE (une mutation) peut soit CRÉER un site RE là où il n'en existait pas auparavant, soit SUPPRIMER ou ÉLIMINER un site RE d'un gène. Une analogie serait de "muter" votre numéro de téléphone par une lettre, les appelants obtiendraient une personne différente.

Pour comprendre les empreintes génétiques de l'ADN, la molécule d'ADN double brin doit être considérée comme une chaîne avec des sites d'enzymes de restriction aléatoire (palindromes) situés le long de sa longueur. Si chacun de ces divers sites de restriction uniques était marqué d'une couleur différente, l'ADN apparaîtrait sous la forme d'un ruban rayé multicolore aléatoire. Si un ensemble de sites d'enzymes de restriction uniques était coloré en ROUGE et que l'enzyme de restriction ROUGE appropriée était ajoutée, l'ADN serait COUVERT en une série de FRAGMENTS DE DIVERSES TAILLES en fonction de l'endroit où les SITES ROUGES étaient situés le long de la molécule d'ADN (Fig. 6) . Il est facile de comprendre que le groupe de FRAGMENTS DE DIFFÉRENTES TAILLES serait UNIQUE pour deux brins d'ADN avec les sites de restriction ROUGE situés à DIFFÉRENTS ENDROITS le long de leurs doubles brins d'ADN respectifs. L'ajout d'une enzyme de restriction GREEN qui coupe les SITES VERT produirait un groupe différent de fragments de taille. Chacun de ces groupes de fragments produits par des enzymes de restriction représenterait une EMPREINTE DIGITALE unique de cet ADN (Fig. 6).

Figure 6. Dans cette FIGURE, il y a deux gènes avec les sites palindromiques pour deux enzymes de restriction différentes MARQUÉS COMME DES BARRES VERTES OU ROUGES. Le nombre et la taille des fragments d'ADN qui résulteraient si l'ADN contenant ces deux gènes était coupé avec les enzymes de restriction respectives sont indiqués. Déterminez le motif que vous obtiendriez si vous coupiez cet ADN avec les DEUX ENZYMES EN MÊME TEMPS, étalez-le du plus petit au plus grand fragment.

Les fragments d'ADN sont visualisés à l'aide de la technique connue sous le nom d'ÉLECTROPHORÈSE DE GEL, que vous avez réalisée dans l'exercice de laboratoire 15. Brièvement, des gels poreux composés soit d'un PLASTIQUE appelé ACRYLAMIDE ou d'un dérivé de l'agar, appelé AGAROSE , sont utilisés pour séparer des fragments d'ADN à base de Taille. Les gels sont préparés avec des puits dans lesquels les fragments d'ADN sont AJOUTÉS. Les gels sont immergés, sous une solution tampon électrolytique entre une électrode positive et une électrode négative, les solutions contenant de l'ADN sont ajoutées aux puits et le courant est activé. Les fragments d'ADN étant CHARGÉS NÉGATIVEMENT, les puits les contenant sont placés au plus près de l'électrode négative. Lorsque le courant est allumé, l'ADN se déplace à travers les pores du gel VERS L'ÉLECTRODE POSITIVE. Les fragments les plus courts se déplacent LE PLUS RAPIDEMENT car ils sont capables de naviguer plus facilement à travers les pores du gel, tandis que les fragments d'ADN plus longs se déplacent PROPORTIONNELLEMENT PLUS LENTEMENT à travers les pores. Le résultat est une séparation des fragments d'ADN en fonction de leur longueur ( TAILLE ). Les ADN sont colorés par des colorants qui se lient à l'ADN et deviennent fortement fluorescents lorsqu'ils sont exposés à la lumière UV. Les fragments d'ADN de différentes tailles apparaissent sous la forme d'une série de bandes qui ressemblent à un CODE BARRE. Voir la figure 13.

MUTATIONS & ADN-EMPREINTE DIGITALE

Sur la figure 7, le modèle de gel d'une analyse hypothétique de l'ADN d'O.J. par rapport à un échantillon d'ADN inconnu est représenté. Les deux ADN isolés ont été traités avec le même RE et les fragments séparés sur un gel d'agarose. Deux motifs uniques de fragments d'enzymes de restriction sont observés. La conclusion est que les échantillons de sang provenaient de DIFFERENTS INDIVIDUS. La SOURCE des ADN influence clairement la signification de ces résultats. Par exemple, si les deux échantillons étaient prélevés sur les lieux du crime, cela signifierait une chose, mais si l'échantillon d'ADN inconnu provenait de la chemise d'OJ et qu'il correspondait à celui de l'une des victimes sur les lieux du crime, le les données prennent plus d'importance.

Figure 7. Il est clair que l'ADN de la scène du crime n'est pas celui d'O.J., car les motifs des fragments (l'empreinte ADN) sont différents. S'ils avaient été les mêmes, que dirait-on de l'innocence ou de la culpabilité d'O.J. ?

HYBRIDATION

RÉPONSE : C'est exactement ce qui se passe. Lorsque l'ADN génomique est traité avec un RE et séparé sur un gel, on voit un frottis continu composé de milliers de fragments d'ADN individuels. Ce problème est résolu par une technique connue sous le nom d'HYBRIDATION.

L'hybridation dépend à nouveau du principe de base de la LIAISON HYDROGÈNE entre les liaisons GC et AT dans les acides nucléiques. Les principes des étapes d'hybridation sont :

Les brins d'ADN sont SÉPARÉS en brisant les liaisons hydrogène entre les bases avec de la chaleur pour produire des brins uniques.

La séparation des brins dépend STRICTEMENT de deux facteurs : la TEMPÉRATURE (quantité d'énergie thermique) et le NOMBRE de liaisons hydrogène (un appariement de bases incorrect ne forme PAS de liaisons H).

Lorsque la température baisse, des brins d'ADN uniques dans la même solution qui sont complémentaires S'ASSOCIENT SPONTANÉMENT en s'appariant par le biais de leurs associations AT & GC respectives. La force de leur association ultérieure dépend de la température et du nombre total de paires de bases ASSORTIES.

L'ADN TEST ou ÉCHANTILLON est généralement FIXE ou LIÉ à une surface solide dans un ÉTAT SIMPLE BROCHE. Un morceau d'ADN de SÉQUENCE CONNUE auquel est attaché quelque chose qui peut être DÉTECTÉ ou VU est ensuite mélangé avec l'ADN lié et les deux sont incubés ensemble dans des conditions qui permettront aux séquences d'ADN COMPLÉMENTAIRES de se joindre par la liaison hydrogène appropriée. La molécule d'ADN qui peut être détectée est appelée SONDE.

Figure 8. Sonde d'hybridation. Un court morceau d'ADN de séquence connue (bases noires) a une substance REPORTER qui lui est attachée. Ce rapporteur est généralement un élément radioactif comme le phosphore-32 ou une enzyme qui induit la production de lumière à partir d'une molécule de substrat et est indiqué sur cette figure par l'ampoule. Si la séquence sonde trouve une séquence de bases complémentaire sur la cible ou l'échantillon d'ADN lié, elle s'y liera par liaison hydrogène. Lorsque l'excès de sonde non liée est éliminé par lavage, l'emplacement de la sonde liée et son ADN complémentaire peuvent être détectés par le REPORTER sur la sonde.

C'est-à-dire que plus il y a de liaisons hydrogène, plus la température doit être ÉLEVÉE pour SÉPARER complètement deux brins d'ADN et les maintenir séparés. Par exemple, s'il y avait deux peuplements d'ADN composés de 200 paires de bases PARFAITEMENT complémentées, il faudrait alors une température de 58°C pour les séparer. Cependant, si seulement 199 des paires de bases étaient correctes, il ne faudrait que 57 o C pour les séparer s'il n'y avait que 100 paires de bases correctes, les brins d'ADN se désintégreraient à

29 o C, c'est-à-dire que moins de liaisons nécessitent moins de chaleur (énergie = températures plus basses) pour les rompre.

Figure 9. Dans cette figure, un court morceau d'ADN, appelé SONDE (Pink Star) est mélangé avec deux longs brins d'ADN différents. L'un de ces longs brins contient une séquence de pb qui correspond exactement à celle de la sonde, tandis que l'autre diffère par rapport à une seule pb (ovale jaune). À 55 °C, la sonde se lie aux DEUX longues molécules d'ADN, mais à 65 °C, la sonde ne se lie pas à la longue molécule d'ADN avec un seul mésappariement de paires de bases. La sonde est incapable de se lier à l'une ou l'autre des molécules d'ADN longues à 90 °C. Selon vous, quels pourraient être les résultats à une température de 60 °C ?

  1. L'ADN isolé est FRAGMENTÉ (CUT) avec des enzymes de restriction.
  2. L'ADN coupé est séparé en fragments selon la TAILLE sur un gel.
  3. Les fragments d'ADN sont transférés, EN POSITION, sur une membrane à laquelle ils se LIENENT ÉTROITEMENT.
  4. L'ADN lié à la membrane est trempé dans une solution contenant de l'ADN-SONDE marquée avec quelque chose qui peut être DÉTECTÉ (vu à l'œil nu).
  5. Le mélange ADN-sonde lié à la membrane est incubé à une température conçue pour que SEULS LES brins d'ADN de la SONDE qui ont un degré élevé de COMPLÉMENTARITÉ (appariement de paires de bases) aux brins d'ADN liés à la membrane puissent se lier (liaison hydrogène ) les uns aux autres.
  6. La sonde non liée est lavée et la position de la sonde liée est déterminée à l'aide de son système de détection de la sonde.

Figure 10. La procédure d'hybridation.

L'ensemble de la procédure s'appelle HYBRIDATION. L'hybridation fonctionne grâce à la SÉQUENCE DE LA SONDE. Une sonde donnée ne se liera à l'ADN qui est attaché à la membrane SI ELLE TROUVE une séquence de paires de bases d'ADN CORRESPONDANTE ou COMPLÉMENTAIRE qui forme suffisamment de liaisons pour rester ensemble dans les conditions de chauffage utilisées. Ainsi, si aucune séquence complémentaire correspondante n'est trouvée, AUCUNE SONDE ne se liera (Fig. 10, ADN vert). Si un ou deux des 1 000 fragments d'ADN liés contiennent une séquence complémentaire à la séquence de la sonde, la sonde se liera uniquement à ces fragments et deviendra donc ATTACHÉE À LA MEMBRANE par cette association avec l'ADN complémentaire lié à la membrane. (Fig. 10, ADN rouge). Il est possible de choisir des sondes connues pour se lier à des séquences spécifiques ou des sondes artificielles de SÉQUENCES CONNUES peuvent être fabriquées, pour environ 1,00 $/base et vous sont envoyées en 48 heures. ILS PEUVENT ÊTRE COMMANDÉS PAR INTERNET.

Figure 11. Le gel d'origine, représenté au milieu, produit un frottis de fragments d'ADN génomique (voir figure 13). Dans ces 1000,s de fragments sont les fragments montrés sur le gel de gauche coupés à partir d'une section des deux molécules d'ADN originales montrées dans le coin supérieur gauche. Lorsque le frottis de fragments, fixé à une membrane, est hybride avec la sonde (ADN avec rapporteur attaché [étoile verte], Fig. 8), la sonde HYBRIDERA (se liera) uniquement aux fragments contenant des séquences d'ADN qui complètent les séquences présentes dans la sonde, c'est-à-dire les régions DIRECTEMENT AU-DESSOUS de l'ADN de la sonde. L'emplacement (ovales roses) de ces fragments complémentaires liés à la membrane est indiqué sur le gel à droite. Ainsi, le système de détection ne "VOIT" que les ovales roses. Voir la figure 13 pour la détection par film radiographique de fragments d'ADN à partir d'un frottis d'ADN génomique.

Figure 12. Projet de devoirs.

Sur la figure 12, trois SONDES différentes (A, B et C) sont hybridées contre les fragments d'ADN liés à la membrane séparés montrés à droite (à partir de 3 gels en double). Comme exercice, déterminez QUELLES BANDES chacune des trois sondes s'hybridera (se liera) à cela, c'est-à-dire, dessinez trois gels en double, 1, 2 et 3 et encerclez la ou les bandes dans le gel 1 auxquelles la sonde A se liera dans les gels 2 & 3 font de même avec les sondes B & C respectivement.

Figure 13. Il s'agit de trois gels expérimentaux montrant le résultat d'une procédure d'hybridation. Le gel A montre le motif de bandes observé lorsque l'ADN génomique, digéré avec une enzyme de restriction, est séparé sur un gel d'agarose. Les frottis dans les pistes 1 à 9 représentent des milliers de fragments d'ADN individuels produits par la digestion par enzyme de restriction. Les bandes observées dans ces voies sont dues à la forte concentration de certains gènes. Les gels B et C montrent des exemples de motifs de bandes obtenus lorsque des frottis d'ADN génomique, liés à une membrane, sont hybridés avec des sondes spécifiques. Les sondes ne se lient ou ne se sont hybridées qu'à quelques-uns des milliers de fragments qui contenaient des séquences de bases COMPLÉMENTAIRES à celles de la sonde. Attachée aux sondes se trouve une substance qui produit de la LUMIÈRE lorsqu'elle est traitée avec certains produits chimiques et cette lumière est détectée avec un film photographique, prenant en fait une photo de chacun des emplacements où les sondes se lient à un fragment d'ADN complémentaire sur la membrane. cliquez ici puis cliquez sur "Hybridisation" pour d'autres dessins animés de Southern Blot et des illustrations d'autres techniques de biologie moléculaire.

La figure 14 illustre comment le sang du procès d'O.J. a été testé pour déterminer les correspondances. L'ADN des différents échantillons de sang (des gants, du Bronco, des chaussettes, des corps etc.) a été extrait, digéré par une ou plusieurs enzymes de restriction, séparé sur gels, transféré sur des membranes liant l'ADN et hybridé avec diverses sondes . Le motif des fragments d'ADN (bandes) des échantillons qui "s'allume" a ensuite été comparé pour les similitudes et les différences.

FAQ : À propos des empreintes génétiques.

1 Quelle est la qualité (précision) de l'identification. Par exemple, est-ce aussi bon que les empreintes digitales classiques ?

Réponse : En théorie, à l'exception des vrais jumeaux, TOUT LE MONDE a une empreinte ADN différente. C'est-à-dire que les empreintes génétiques EST aussi bonnes (distinctives) que les empreintes digitales classiques pour l'identification.

2. Quels sont ses avantages ?

Réponse : En théorie, les empreintes génétiques fonctionneront avec des quantités beaucoup plus petites de matériel qu'une empreinte digitale classique et l'ADN dure beaucoup plus longtemps que les empreintes digitales classiques. Les échantillons contenant de l'ADN qui ont plusieurs années (jusqu'à 25 millions d'années) sont toujours utilisables. Seules de très petites quantités d'ADN sont nécessaires pour effectuer un test très précis. Par exemple, le sang séché, le sperme, la salive, la peau, etc. sur des échantillons stockés dans des dossiers poussiéreux depuis des années sont toujours utilisables. Des échantillons d'ADN mixtes peuvent également être utilisés. L'ADN contenant des preuves est beaucoup plus difficile à nettoyer sur une scène de crime que d'autres preuves, comme les empreintes digitales classiques.

3. Quelles sont ses limites ?

Réponse : Il n'existe actuellement aucune norme fédérale acceptée pour contrôler la qualité des tests ADN à l'échelle nationale. Des tests de mauvaise qualité et mal contrôlés conduisent à des RÉSULTATS DOUTEUX et DE MAUVAISE. Le laboratoire A peut utiliser un ensemble de procédures et de normes, tandis que le laboratoire B peut utiliser un autre ensemble de procédures et de normes. Il est difficile de comparer les résultats des deux laboratoires. La qualité du personnel de laboratoire n'est pas standardisée. Par exemple, les techniciens de laboratoire clinique, qui travaillent dans les hôpitaux et les laboratoires cliniques, doivent être certifiés par leurs États et par une organisation nationale qui établit des normes élevées de formation et d'expérience. Les laboratoires cliniques sont fréquemment testés pour déterminer si leurs procédures sont effectuées correctement. Ils reçoivent et doivent analyser des échantillons d'essai dont la composition est connue par les organismes de certification. Les résultats sont retournés aux agences de certification pour évaluation. Si un laboratoire clinique fait trop d'erreurs, le laboratoire sera DÉCERTIFIÉ. Ce n'est pas encore le cas avec les installations de test ADN.

Pensez-vous qu'il devrait y avoir un ensemble de normes nationales pour les tests ADN ou que chaque État devrait établir ses propres normes ?

Même s'il existe une correspondance parfaite entre les ADN, vous ne pouvez pas dire COMMENT l'échantillon contenant l'ADN est arrivé là ou QUAND . Dans l'O.J. procès, une question VALIDE a été soulevée au sujet de la possibilité que des preuves soient déposées. Ce qui rend cette charge si puissante, c'est l'EXTRÊME SENSIBILITÉ de la procédure. C'est-à-dire qu'il NE SERAIT PAS DIFFICILE pour quelqu'un de prélever une petite quantité de sang (une ou deux gouttes d'un tube d'un échantillon de sang), de fluide corporel ou de tissu d'une victime (par exemple des cheveux dans un peigne, du sang sur un Kleenex, etc. . ) et placer ce matériel là où il incriminerait une personne innocente.Il existe des cas documentés où des quantités de drogue, d'argent marqué, etc.

Enfin, le sang mélangé avec les mauvais produits chimiques ou dégradé est difficile à analyser avec précision.

4. Face à des preuves ADN, quelles questions faut-il poser ?

Réponse : Comme indiqué ci-dessus (et dans l'essai OJ), les questions concernant le traitement des preuves, la qualité des tests, y compris les contrôles de qualité utilisés, les compétences du personnel chargé des tests, l'exactitude de l'interprétation des données, la contamination possible des les preuves, la possibilité d'un déplacement accidentel ou intentionnel de preuves sont toutes des questions valables qui devraient être soulevées concernant les preuves ADN (ou toute preuve d'ailleurs). Au fur et à mesure que la sensibilité de cette technique puissante s'améliore et que son utilisation s'étend à l'ensemble de notre système judiciaire, il est important que nous traitions ces problèmes si nous attendons une JUSTICE ÉGALE pour tous. Nous ne devons pas perdre de vue que, quelle que soit la puissance d'un nouvel outil de lutte contre le crime, son efficacité ultime n'est qu'aussi bonne que les personnes qui l'utilisent .

Pensez-vous que O.J. l'avez-vous fait et si oui, comment auriez-vous voté en vous basant uniquement sur les preuves si vous aviez été membre du jury ?

RÉACTION EN CHAÎNE DE POLYMÉRASE

La PCR est une autre de ces découvertes, comme celle de la structure de l'ADN, le facteur de transformation déterminant la nature chimique de l'ADN, et des enzymes de restriction, qui ont généré un saut quantique dans la science. Presque à l'instant où la PCR est expliquée à un biologiste, des idées sur ses utilisations commencent à jaillir de tous, sauf de l'esprit scientifique le plus ennuyeux. Même aujourd'hui, des années après sa découverte, nous développons toujours de nouvelles utilisations de la PCR.

L'ironie de la PCR est que les organismes vivants le font depuis qu'ils ont évolué dans la soupe organique primitive de cette planète il y a 3,5 milliards d'années et que les scientifiques sont conscients des DÉTAILS généraux de ce processus depuis

50 ans. Pour le dire succinctement, la PCR fait dans le tube à essai ce que chaque bactérie fait dans son tube de milieu ou sur une plaque de gélose et chacun de nous fait chaque jour nous produisons tous des milliards de copies exactes de notre propre ADN AMPLIFIANT notre ADN des millions de temps. L'enzyme ADN polymérase a été découverte dans les années 1950 et notre connaissance du processus n'a cessé de croître depuis. Cela signifie que des milliers de scientifiques ont étudié la réplication de l'ADN pendant 40 ans sans passer à la PCR.

Le principe de base de la PCR est illustré à la figure 15. On sait depuis longtemps que l'ADN polymérase nécessite un court support d'ADN ou d'ARN appelé AMORÇAGE pour « amorcer » le DÉBUT DE LA RÉPLICATION DE L'ADN. Le génie de Mullis était qu'il raisonnait « que si vous ajoutiez les composants suivants à un tube à essai contenant une seule molécule d'ADN, vous pourriez reproduire et amplifier cette molécule d'ADN plusieurs millions de fois en peu de temps.

Un échantillon de l'ADN CIBLE à copier. En théorie, une seule molécule est nécessaire.

Un ensemble d'amorces courtes (15 à 40 bases) d'ADN simple brin, en EXCES , qui se lieront aux régions complémentaires des peuplements opposés de la molécule d'ADN CIBLE . Ces amorces FIXENT la région de l'ADN à amplifier.

Un EXCES des 4 nucléotides triphosphates, ATP, GTP, CTP, TTP.

L'enzyme, l'ADN polymérase.

Divers tampons et cofacteurs comme les ions magnésium requis par l'ADN polymérase.

L'astuce finale consistait à séparer les deux supports d'ADN cibles (séparés) afin que les amorces puissent se lier et que l'ADN polymérase puisse faire son travail. Il était connu depuis

50 ans que la chaleur sépare les peuplements d'ADN et que les brins complémentaires se rejoignent ensuite par appariement de bases lorsque la température est ensuite abaissée. Mullis a donc chauffé son mélange d'ADN cible, d'amorces et de nucléotides triphosphates à environ 90 °C pendant quelques minutes pour séparer l'ADN cible. Il a ensuite abaissé suffisamment la température pour permettre aux amorces, qui étaient petites et en VAST EXCESS, de se lier (ANNEAL) à leurs séquences pb d'ADN cibles complémentaires respectives. À ce stade, il a ajouté de l'ADN polymérase et a permis à la réaction de polymérisation avec les nucléotides triphosphate de se produire. C'est-à-dire que l'ADN polymérase a REMPLI la partie manquante de chaque brin, créant DEUX NOUVELLES régions d'ADN DOUBLE BRINS.

Figure 15. La réaction en chaîne par polymérase. Pour une autre figure illustrant la PCR, cliquez ici et consultez le lien "PCR".

Chaque cycle PCR complet ne prend que 2 à 10 minutes. Cependant, il y avait un problème avec le système conçu par K. Mullis, qui était que l'ADN polymérase qu'il utilisait était détruite par le processus de chauffage. Mullis a dû ajouter une nouvelle ADN polymérase pour CHAQUE TOUR, ce qui était long et coûteux. Ce problème a été résolu en utilisant une ADN polymérase RÉSISTANTE À LA CHALEUR qui ne devait être ajoutée qu'une seule fois. Les bactéries THERMOPHILES qui vivent dans les sources chaudes bouillantes ont été décrites précédemment. C'est un autre cas de SERENDIPITOUS BASIC SCIENCE qui s'avère important. L'étude des thermophiles peut sembler être une perte de temps et d'argent pour de nombreuses personnes, car ces bactéries, bien que certainement intéressantes, ne causent pas de maladie chez l'homme ou toute autre forme de vie. L'argument pourrait être avancé qu'un scientifique pourrait mieux passer son temps à travailler sur le cancer ou une autre maladie terrible qui afflige l'humanité. Cependant, il s'avère que puisque les ADN polymérases thermophiles tolèrent des températures élevées (par exemple 90 ° C) pendant de longues périodes sans être détruites, elles constituent la solution parfaite au problème de l'ADN polymérase PCR. Ainsi, aujourd'hui, la PCR est devenue un outil révolutionnaire grâce aux scientifiques qui ont étudié ces étranges thermophiles.

Figure 16. Cette figure représente une autre perspective de la réaction PCR. Il convient de noter en particulier l'utilisation de la PCR pour AMPLIFIER DES SEGMENTS D'ADN SPÉCIFIQUES dépendant des AMORCES EMPLOYÉES. En choisissant des amorces avec des séquences uniques, on FIXE une longueur connue (gène[s]) d'une molécule d'ADN. Le segment entre crochets est indiqué par les lignes pointillées. Les amorces rouges et bleues, par leur LIAISON COMPLÉMENTAIRE aux séquences pb sur les deux brins d'ADN parentaux respectifs, garantissent que SEULE la portion d'ADN entre elles sera amplifiée. Cinq cycles de réplication sont indiqués, sauf que le dernier cycle est incomplet. Notez que le nombre de molécules d'ADN augmente EXPONENTIELLEMENT à chaque cycle de réplication.

La réaction PCR standard est exécutée sur environ 30 cycles en quelques heures, ce qui entraîne l'amplification de l'ADN d'origine de plus de 10 9 fois. Ainsi, une seule région d'ADN spécifique peut être amplifiée pour produire des quantités suffisantes pour faire tout ce qui peut être fait avec de l'ADN isolé en vrac. Dans le cas d'une preuve de crime, cela signifie que l'ADN d'un seul follicule pileux, une seule goutte de sperme ou de sang suffit à prouver qu'un individu était présent sur les lieux d'un crime. En effet, tout élément de preuve contenant un ou plusieurs fragments d'ADN modérément longs (par exemple > 200 paires de bases) peut être amplifié par PCR et son RFLP déterminé à des fins d'identification --- ou peut-être pour éventuellement construire un dinosaure. Cependant, à l'heure actuelle, la limite maximale d'amplification est d'environ 42 kilobases.

RÉSUMÉ DE L'EMPREINTE DIGITALE ADN

Les principales limites des empreintes génétiques sont l'erreur humaine et la qualité de la technologie utilisée.

La découverte de la PCR a augmenté la sensibilité et la polyvalence des empreintes génétiques et a changé le visage de la biologie moléculaire.

Ces techniques permettront d'identifier les maladies infectieuses en quelques heures, voire quelques minutes. Ils accélèrent le rythme de séquençage du génome humain, ils permettent l'étude d'interactions écologiques complexes et de relations entre espèces qui, jusqu'à présent, étaient trop complexes à étudier.

BIENVENUE DANS LE NOUVEAU MONDE DE L'INGÉNIERIE GÉNÉTIQUE, GARDER JUSTE VOS CEINTURES DE SÉCURITÉ ATTACHÉES PARCE QUE CE VA ÊTRE UNE RANDONNÉE SAUVAGE.


Que se passe-t-il si nous injectons une enzyme de restriction dans le sang - Biologie

et les plus gros fragments près de l'électrode négative.

---------------

Une fois le gel « passé », il ne reste plus qu'à illuminer les fragments d'ADN. Avec la PCR, le gel entier est simplement

trempé dans une solution de coloration. Les fragments d'ADN apparaissent sous forme de petites bandes sur le gel et nous pouvons déterminer leur approximation

longueur par leur position sur le gel. Pour éclairer le profil ADN d'une analyse RFLP, nous devons d'abord l'exposer à

des sondes marquées radioactivement, qui ciblent spécifiquement les séquences STR que nous essayons de trouver. Ensuite, nous pouvons exposer

à un film radiographique, qui ne visualisera que les fragments détectés par les sondes marquées radioactivement. Aussi long

comme les mêmes techniques sont utilisées pour préparer tous les échantillons d'un test, une comparaison directe des profils ADN est un

manière précise de faire correspondre les identités ou de confirmer les relations. Le profil ADN d'une personne sera d'environ 50/50

combinaison de sa mère et de son père. Une correspondance exacte du profil ADN indique soit que les deux échantillons ont été



Commentaires:

  1. Wahchintonka

    Vous voyez, le point ici est ce qui est considéré comme correct et ce qui ne l'est pas;) et donc le sujet est bon, bien sûr, le respect de l'auteur.

  2. Quincy

    Vous êtes des gens très talentueux

  3. Dru

    Merci pour vos informations, j'aimerais aussi quelque chose que vous pouvez aider?

  4. Gara

    Volontiers j'accepte. La question est intéressante, moi aussi je participerai à la discussion. Ensemble nous pouvons arriver à la bonne réponse.



Écrire un message