Informations

16.12 : Clonage - Biologie

16.12 : Clonage - Biologie



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Clonage moléculaire

En général, le mot « clonage » signifie la création d'une réplique parfaite ; cependant, en biologie, la recréation d'un organisme entier est appelée « clonage reproductif ». Bien avant que des tentatives ne soient faites pour cloner un organisme entier, les chercheurs ont appris à reproduire des régions ou des fragments souhaités du génome, un processus appelé clonage moléculaire.

Le clonage de petits fragments du génome permet la manipulation et l'étude de gènes spécifiques (et de leurs produits protéiques) ou de régions non codantes de manière isolée. Un plasmide (également appelé vecteur) est une petite molécule d'ADN circulaire qui se réplique indépendamment de l'ADN chromosomique de micro-organismes tels que E. coli. Lors du clonage, les molécules plasmidiques peuvent être utilisées pour fournir un « dossier » dans lequel insérer un fragment d'ADN souhaité. Les plasmides sont généralement introduits dans un hôte bactérien pour la prolifération. Dans le contexte bactérien, le fragment d'ADN du génome humain (ou du génome d'un autre organisme étudié) est appelé ADN étranger, ou un transgène, pour le différencier de l'ADN de la bactérie, que l'on appelle le ADN hôte.

Les plasmides sont présents naturellement dans les populations bactériennes (telles que Escherichia coli) et ont des gènes qui peuvent apporter des traits favorables à l'organisme, tels que résistance aux antibiotiques (la capacité de ne pas être affecté par les antibiotiques). Les plasmides ont été réutilisés et conçus comme vecteurs pour le clonage moléculaire et la production à grande échelle de réactifs importants, tels que l'insuline et l'hormone de croissance humaine. Une caractéristique importante des vecteurs plasmidiques est la facilité avec laquelle un fragment d'ADN étranger peut être introduit via le site de clonage multiple (MCS). Le MCS est une courte séquence d'ADN contenant plusieurs sites qui peuvent être coupés avec différentes endonucléases de restriction couramment disponibles. Endonucléases de restriction reconnaître des séquences d'ADN spécifiques et les couper de manière prévisible ; ils sont naturellement produits par les bactéries en tant que mécanisme de défense contre l'ADN étranger. De nombreuses endonucléases de restriction effectuent des coupes décalées dans les deux brins d'ADN, de sorte que les extrémités coupées ont un surplomb monocaténaire de 2 ou 4 bases. Parce que ces surplombs sont capables de recuit avec des surplombs complémentaires, ceux-ci sont appelés « extrémités collantes ». L'ajout d'une enzyme appelée ADN ligase rejoint en permanence les fragments d'ADN via des liaisons phosphodiester. De cette manière, tout fragment d'ADN généré par clivage par endonucléase de restriction peut être épissé entre les deux extrémités d'un ADN plasmidique qui a été coupé avec la même endonucléase de restriction (figure 1).

Molécules d'ADN recombinant

Les plasmides contenant de l'ADN étranger sont appelés ADN recombiné molécules parce qu'elles sont créées artificiellement et ne se produisent pas dans la nature. Ils sont également appelés molécules chimériques car l'origine de différentes parties des molécules peut être retracée à différentes espèces d'organismes biologiques ou même à la synthèse chimique. Les protéines qui sont exprimées à partir de molécules d'ADN recombinant sont appelées protéines recombinantes. Tous les plasmides recombinants ne sont pas capables d'exprimer des gènes. L'ADN recombinant peut devoir être déplacé dans un vecteur (ou hôte) différent qui est mieux conçu pour l'expression génique. Les plasmides peuvent également être modifiés pour exprimer des protéines uniquement lorsqu'ils sont stimulés par certains facteurs environnementaux, afin que les scientifiques puissent contrôler l'expression des protéines recombinantes.

Visualisez une animation de recombinaison en clonage depuis le DNA Learning Center.

Clonage cellulaire

Les organismes unicellulaires, tels que les bactéries et les levures, produisent naturellement des clones d'eux-mêmes lorsqu'ils se répliquent de manière asexuée par fission binaire ; c'est ce qu'on appelle clonage cellulaire. L'ADN nucléaire se duplique par le processus de mitose, qui crée une réplique exacte du matériel génétique.

Question de pratique

Vous travaillez dans un laboratoire de biologie moléculaire et, à votre insu, votre partenaire de laboratoire a laissé l'ADN génomique étranger que vous envisagez de cloner sur la paillasse du laboratoire pendant la nuit au lieu de le stocker au congélateur. En conséquence, il a été dégradé par les nucléases, mais toujours utilisé dans l'expérience. Le plasmide, par contre, est très bien. Quels résultats attendez-vous de votre expérience de clonage moléculaire ?

  1. Il n'y aura pas de colonies sur la plaque bactérienne.
  2. Il n'y aura que des colonies bleues.
  3. Il y aura des colonies bleues et blanches.
  4. Les colonies seront blanches uniquement.

[révéler-réponse q="511969″]Montrer la réponse[/révéler-réponse]
[hidden-answer a="511969″]Réponse b. L'expérience ne donnerait que des colonies bleues.[/hidden-answer]

Clonage reproductif

Clonage reproductif est une méthode utilisée pour faire un clone ou une copie identique d'un organisme multicellulaire entier. La plupart des organismes multicellulaires subissent une reproduction par voie sexuée, ce qui implique l'hybridation génétique de deux individus (parents), ce qui rend impossible la génération d'une copie identique ou d'un clone de l'un ou l'autre des parents. Les progrès récents de la biotechnologie ont permis d'induire artificiellement la reproduction asexuée de mammifères en laboratoire.

La parthénogenèse, ou « naissance vierge », se produit lorsqu'un embryon grandit et se développe sans que la fécondation de l'ovule ne se produise ; c'est une forme de reproduction asexuée. Un exemple de parthénogenèse se produit chez les espèces dans lesquelles la femelle pond un œuf et si l'œuf est fécondé, c'est un œuf diploïde et l'individu se développe en femelle ; si l'œuf n'est pas fécondé, il reste un œuf haploïde et se développe en mâle. L'œuf non fécondé est appelé œuf parthénogénique ou vierge. Certains insectes et reptiles pondent des œufs parthénogéniques qui peuvent devenir des adultes.

La reproduction sexuée nécessite deux cellules; lorsque l'ovule haploïde et les spermatozoïdes fusionnent, il en résulte un zygote diploïde. Le noyau du zygote contient l'information génétique pour produire un nouvel individu. Cependant, le développement embryonnaire précoce nécessite le matériel cytoplasmique contenu dans l'ovule. Cette idée constitue la base du clonage reproductif. Par conséquent, si le noyau haploïde d'un ovule est remplacé par un noyau diploïde provenant de la cellule d'un individu de la même espèce (appelé donneur), il deviendra un zygote génétiquement identique au donneur. Le transfert nucléaire de cellules somatiques est la technique consistant à transférer un noyau diploïde dans un ovule énucléé. Il peut être utilisé pour le clonage thérapeutique ou le clonage reproductif.

Le premier animal cloné était Dolly, une brebis née en 1996. Le taux de réussite du clonage reproductif à l'époque était très faible. Dolly a vécu sept ans et est décédé de complications respiratoires (Figure 2). Il y a des spéculations que parce que l'ADN cellulaire appartient à un individu plus âgé, l'âge de l'ADN peut affecter l'espérance de vie d'un individu cloné. Depuis Dolly, plusieurs animaux tels que des chevaux, des taureaux et des chèvres ont été clonés avec succès, bien que ces individus présentent souvent des anomalies faciales, des membres et cardiaques. Il y a eu des tentatives pour produire des embryons humains clonés en tant que sources de cellules souches embryonnaires, parfois appelées clonage à des fins thérapeutiques. Le clonage thérapeutique produit des cellules souches pour tenter de remédier à des maladies ou défauts néfastes (contrairement au clonage reproductif, qui vise à reproduire un organisme). Pourtant, les efforts de clonage thérapeutique ont rencontré une résistance en raison de considérations bioéthiques.

Question de pratique

Pensez-vous que Dolly était une brebis Finn-Dorset ou écossaise Blackface ?

[practice-area rows="2″][/practice-area]
[révéler-réponse q="985505″]Montrer la réponse[/révéler-réponse]
[hidden-answer a=”985505″]Dolly était un mouton Finn-Dorset car même si la cellule d'origine provenait d'un mouton écossais blackface et que la mère porteuse était un blackface écossais, l'ADN provenait d'un Finn-Dorset.[/hidden -réponse]


Un système bio-inspiré sans cellules pour la production de cannabinoïdes à partir d'intrants peu coûteux

Déplacer la production de cannabinoïdes loin des caprices de l'extraction végétale et vers des microbes modifiés pourrait fournir une source cohérente, plus pure, moins chère et sans danger pour l'environnement de ces molécules thérapeutiques importantes, mais la production microbienne fait face à des défis notables. Une alternative aux microbes et aux plantes consiste à supprimer la complexité des systèmes cellulaires en utilisant la biosynthèse enzymatique. Ici, nous concevons et mettons en œuvre un nouveau système sans cellules pour la production de cannabinoïdes avec les caractéristiques suivantes : (1) seuls des intrants à faible coût sont nécessaires (2) seulement 12 enzymes sont utilisées (3) le système ne nécessite pas d'oxygène et (4) nous utilisons un système enzymatique non naturel pour réduire les besoins en ATP qui est généralement applicable aux voies dépendantes du malonyl-CoA telles que la biosynthèse des polycétides. Le système produit

0,5 g l -1 d'acide cannabigérolique (CBGA) ou d'acide cannabigérovarinique (CBGVA) à partir d'intrants à faible coût, soit près de deux ordres de grandeur de plus que la production à base de levure. Des systèmes sans cellules tels que celui-ci peuvent fournir une nouvelle voie vers une production fiable de cannabinoïdes.


MATÉRIAUX ET MÉTHODES

Amplification par PCR pour l'isolement initial d'un nouvel ADN génomique de récepteur. L'amorce directe (OPS3 : CATAGCCCTCGACCGGTACT) code pour l'extrémité cytoplasmique du troisième domaine transmembranaire duDrosophile récepteur octopamine/tyramine (OctyR99AB) (Arakawa et al., 1990). L'amorce inverse (OPS4 : GGCAGCCAGCAGATGACGAA) code pour la région médiane du domaine transmembranaire VI de ce récepteur. Le modèle PCR était de 300 ng de Drosophile ADN génomique préparé à partir de mouches adultes Canton-S de type sauvage (Jowett, 1986). Le mélange PCR 100 l contenait 0,2 m m chacun de désoxyribonucléotide triphosphate, 10 m m de tampon Tris-HCl, pH 8,3, 50 m m KCl, 1,5 m m MgCl2, 0,001 % de gélatine, 0,1 µm de chaque amorce et 2,5 unités d'ADN polymérase AmpliTaq (Perkin-Elmer, Norwalk, CT). La PCR a été réalisée dans des conditions de recuit de stringence réduite : 94°C pendant 2 min, 33°C pendant 2 min, 72°C pendant 2 min pendant 6 cycles suivis de 31 cycles supplémentaires avec une température de recuit de 42°C au lieu de 33° C. L'extension finale était de 10 min à 72°C. Les produits de PCR ont été analysés par électrophorèse de 10 µl de mélange réactionnel sur un gel d'agarose 1%.

Séquençage ADN. Le séquençage direct du produit PCR a été effectué comme décrit précédemment (Feng et al., 1995 Zheng et al., 1995) en utilisant un Taq Kit de séquençage de cycle d'amorce de colorant (Applied Biosystems, Foster City, CA). Pour faciliter le séquençage du clone d'ADNc, des délétions imbriquées ont été utilisées (Henikoff, 1987). Chaque segment d'ADN a été séquencé au moins deux fois dans les deux sens. Le contig a été assemblé à l'aide du logiciel Geneworks (Intelligenetics, Mountain View, CA).

Criblage de clones d'ADNc. Le fragment de 0,68 kb de l'expérience d'amplification PCR initiale a été marqué avec du [α-32 P]dCTP (∼ 110 TBq/mmol) en utilisant le système de marquage d'ADN Multiprime (Amersham, Arlington Heights, IL) et a été utilisé pour cribler un Drosophile head cDNA library (Itoh et al., 1985) dans Agt11, généreusement fournie par le Dr Paul Salvaterra (Beckman Research Institute, Duarte, CA). Quatre clones positifs ont été identifiés par criblage à haute stringence (Sambrook et al., 1989) de 4 × 10 5 unités formant des plages (pfu). L'insert le plus long (4 ko) a été découpé avec ÉcoRI et sous-cloné dans pBluescript II SK(-) pour une analyse plus approfondie. Cet insert et le gène qui le code sont appelés DopR99B tout au long de cet article.

taches du nord. Les têtes, les corps et les appendices (pattes et antennes) ont été isolés de mouches adultes congelées (Schmidt-Nielsen et al., 1977). L'ARN poly(A)+ et les transferts ont été préparés comme décrit précédemment (Feng et al., 1995 Zheng et al., 1995). Le poly(A) + ARN (10 ug/piste) a été passé sur un gel dénaturant d'agarose formaldéhyde (0,8 %). Les transferts ont été sondés avec le fragment PCR de 0,68 kb marqué au 32P ajouté à une concentration finale de 106 cpm/ml. Après un lavage à haute stringence (Feng et al., 1995 Zheng et al., 1995), les transferts ont été exposés à un film radiographique pendant 24 heures à -70°C.

In situ hybridation à des courges chromosomiques des glandes salivaires.Le fragment PCR de 0,68 kb a été biotinylé, hybride à des courges de chromosomes polytènes des glandes salivaires larvaires et localisé en utilisant le kit de détection Bluegene de Gibco (Gaithersburg, MD) tel que décrit par Engels et al. (1985) avec des modifications mineures (Feng et al., 1995 Zheng et al., 1995).

Expression dans Xénope ovocytes. L'ARNc Sense a été préparé in vitro du clone DopR99B dans le vecteur pBluescript II SK(-) en utilisant l'ARN polymérase T7 (Stratagene, La Jolla, CA) après linéarisation du plasmide avec PasI (Promega, Madison, WI). Les transcriptions ont été coiffées en ajoutant 0,75 unité de m 7 G(5')ppp(5')G (Boehringer Mannheim, Indianapolis, IN) à une réaction de transcription standard de 150 ul (kit Stratagene).

Ovocytes de stade V et VI d'une femelle adulte vierge Xénope laevis ont été séparés manuellement et placés en milieu ND96 stérile [en m m : NaCl 96, KCl 2, CaCl2 1,8, MgCl2 1, tampon HEPES (pH 7,6) 5, contenant 2,4 mm de pyruvate de sodium, 100 U/ml de pénicilline, 0,1 mg/ml de streptomycine, 0,2 mg/ml de gentamycine]. Les ovocytes ont été défolliculés par voie enzymatique par incubation dans du ND96 contenant de la collagénase (2 mg/ml) pendant 30 min. Les ovocytes ont ensuite reçu une injection de 50 ng de Drosophile Le récepteur DopR99B détecte l'ARNc et incubé à 19 °C pendant 2 à 5 jours. Des ovocytes non injectés ont été utilisés comme témoins.

Des enregistrements électrophysiologiques ont été réalisés à partir d'ovocytes en utilisant une technique de voltage-clamp à deux microélectrodes, à un potentiel de maintien de -60 mV, pour mesurer les courants d'ovocytes (Van Renterghem et al., 1987). Les ovocytes ont été continuellement surfusés avec du ND96 pendant les expériences à température ambiante, et des médicaments ont été ajoutés au superfusat.

dosages de l'AMPc. Pour surveiller les niveaux d'AMPc, des ovocytes individuels ont été pré-incubés pendant 30 min dans ND96 plus 100 m d'isobutylméthylxanthine (IBMX). Les ovocytes expérimentaux ont été incubés pendant 30 minutes supplémentaires avec la concentration souhaitée d'agoniste dans le même milieu tandis que les ovocytes témoins (pour mesurer les niveaux basaux d'AMPc) ont été incubés en parallèle dans le même milieu sans agoniste. Après les incubations, chaque ovocyte a été homogénéisé dans 500 µl d'éthanol acidifié, centrifugé pour éliminer les particules et le surnageant a été évaporé à sec dans une centrifugeuse sous vide (Savant, Farmingdale, NY). Chaque échantillon a été repris dans 60 µl de tampon de dosage et dosé pour l'AMPc en utilisant un kit de dosage commercial (Amersham).

Médicaments. Les médicaments utilisés dans la classification du récepteur exprimé ont été obtenus à partir des sources suivantes : chlorhydrate de dopamine, (-)-chlorhydrate de norépinéphrine, (-)-épinéphrine, chlorhydrate de tyramine, dl -chlorhydrate d'octopamine, chlorhydrate de 5-hydroxytryptamine, (±)- le chlorhydrate d'isoprotérénol, le chlorhydrate de phentolamine et le dl-propranolol provenaient de Sigma (Poole, Dorset, Royaume-Uni) R(+)-SKF-38393 [R(+)-1-phényl-2,3,4,5-tétrahydro-(1H)-3-benzazépine-7,8-diol], quineloranedichlorhydrate, (−)-quinpirole hydrochloride, PD-128,907 [(+)- (4aR,10bR)-3,4,4a,10b-tétrahydro4-propyl-2H,5H-(1)benzopyrano-(4,3-b)-1,4-oxazine-9-vieux-chlorhydrate],cisdichlorhydrate de -(Z)-flupenthixol,R(+)SCH-23390 [RChlorhydrate de (+)-7chloro-8-hydroxy-3-méthyl-1-phényl-2,3,4,5-tétrahydro-1H-3-benzépine], S(−)-sulpiride, chlorhydrate de spipérone, (+)- chlorhydrate de butaclamol, chlorhydrate de S(−)-eticlopride, dompéridone, (+)-bromocriptine méthanesulfonate, (±)-6-chloro-APB [(±)-6-chloro-7,8-dihydroxy-3-allyl-1- bromhydrate de phényl-2,3,4,5-tétrahydro-1H-3benzazépine], R(+)-6-bromo-APB (R(+)-6-bromo7, 8-dihydroxy-3-allyl-1-phényl-2,3,4,5-tétrahydro-1H-3-benzazépine hydrobromure), (±)-6-chloro-PB [ (±)-6-chloro-7,8-dihydroxy-1-phényl-2,3,4,5-tétrahydro-1H-3-benzazépine bromhydrate] et (±)-PPHT [(±)-2-(N-phényléthyle-N-propyl)amino-5-hydroxytétraline hydrochloride] provenaient de Research Biochemicals (Natick, MA).


2 réponses 2

J'ai travaillé pendant longtemps dans une entreprise leader dans le domaine des anticorps de haute qualité, je vais donc essayer de partager certaines de mes expériences avec vous. Le processus de fabrication d'un anticorps hautement spécifique (je me concentrerai sur les monoclonaux) comporte trois parties importantes - la conception et l'immunisation de l'antigène, le clonage et le sous-clonage, et le dépistage/validation. Chaque partie est cruciale en elle-même, et mieux elle est exécutée, plus vos chances de succès en aval sont élevées.

Pour qu'un anticorps fonctionne, il doit se lier spécifiquement à sa cible. Je n'entrerai pas dans tous les détails ici, car il existe une bonne littérature ouverte sur la conception d'antigènes, mais fondamentalement, vous avez besoin de quelque chose qui favorisera une forte réponse immunitaire chez l'hôte, vous donnera une variété de clones parmi lesquels choisir et sera spécifique - il ne devrait pas lier d'autres cibles en plus de votre protéine d'intérêt. De nombreux facteurs doivent être pris en compte, notamment l'antigénicité, la solubilité, la facilité de production (pour l'immunisation et le dépistage), les considérations stériques (une autre protéine ou un autre acide nucléique masque-t-il le site cible ? in vivo?), et d'autres. Les antigènes peuvent être grossièrement divisés en deux types - les peptides (généralement moins de 20 ou 30 acides aminés) et les protéines ou fragments de protéines. Vous voudrez probablement essayer plusieurs antigènes pour maximiser vos chances de succès. Une fois l'antigène synthétisé et purifié, vous devez établir un calendrier d'immunisation pour l'amorçage et le rappel du ou des animaux, puis déterminer quand et comment les tester (dépistage), et à quel moment et comment le récolter pour le processus monoclonal.

Le processus de clonage vient ensuite. Les clones peuvent être générés par une variété de méthodes, certaines largement disponibles, telles que les diverses méthodes d'hybridome, et certaines exclusives à des sociétés individuelles. Mon ancienne entreprise employait un mélange des deux, en fonction de l'espèce animale, en utilisant des technologies internes vraiment cool qui étaient constamment améliorées et développées. Ces procédés sont très dépendants de la qualité des matériaux utilisés et de l'expertise des cloneurs. Les cellules B d'entrée (qui fabriquent les anticorps) doivent avoir été récoltées, traitées et stockées selon un ensemble d'étapes précises pour permettre le plus grand nombre de clones viables. Une fois les cellules immortalisées obtenues (après fusion avec les cellules partenaires du myélome dans le processus d'hybridome, par exemple), elles sont diluées à un nombre de cellules prédéterminé et ensemencées dans des plaques à 96 puits et laissées récupérer et croître pendant un certain temps, pendant laquelle ils sécrètent des anticorps dans le milieu. Ce milieu est ensuite testé rapidement (avant que les cellules ne envahissent le puits), et les puits positifs sont dilués (espérons-le) en suspensions unicellulaires et sous-clonés, ou congelés pour plus tard. Le premier test est fréquemment effectué par ELISA en utilisant l'antigène immunisant, bien que, selon votre application d'intérêt, il puisse s'agir d'un criblage à haut débit par cytométrie en flux, immunohistochimie ou immunofluorescence. Après le test initial, les étapes suivantes de sous-clonage et de nouveau test peuvent avoir lieu à un rythme plus mesuré, car les cellules peuvent être congelées indéfiniment après avoir généré des quantités suffisantes d'anticorps dans le surnageant.

C'est là qu'intervient la qualité de votre programme de dépistage. Vos tests doivent être bien conçus, robustes, bien documentés et effectués, et avoir des contrôles positifs et négatifs appropriés afin que vous puissiez vraiment dire si un certain clone présente un intérêt, ou fonctionne mieux qu'un produit existant. Cela signifie des conditions contrôlées, des réactifs et des protocoles standardisés et un degré élevé de répétabilité d'un essai à l'autre. En outre, la pertinence de vos contrôles ne peut pas être suffisamment soulignée. Avez-vous un échantillon knock-out ou non-exprimant à des fins de comparaison, ou un moyen de comparer l'activité de base par rapport à l'activité induite ou inhibée ? Pour ChIP, à moins que vous n'ayez une bonne paire d'anticorps de contrôle et d'amorces pour votre gène d'intérêt, comment saurez-vous si le test fonctionne ? Vous pouvez obtenir un excellent résultat en effectuant un transfert d'immunoprécipitation-Western direct, sans toutefois éliminer la protéine liée à l'ADN. Si votre méthode ChIP ne produit pas d'ADN propre, vous risquez de ne jamais obtenir de liaison. Et si vous n'avez pas mis en place de protocoles d'analyse de données appropriés avec plusieurs puits répliqués, vous risquez de perdre du temps à rechercher le bruit au lieu d'un signal spécifique. De plus, en plus de tester tous vos clones, vous devez également les titrer pour déterminer la concentration de travail optimale. J'ai vu beaucoup d'anticorps qui ressemblent à de la merde lorsque vous testez le supe pour la première fois, mais dilués 100 ou 1000X, ils sont propres, spécifiques et toujours forts. Soyez patient, les tests sont beaucoup de travail et nécessitent une tonne de répétitions pour confirmer vos résultats, mais cela en vaudra la peine au final.

Enfin, une fois tout cela fait, vous avez, espérons-le, un excellent clone qui fait ce que vous voulez qu'il fasse, et mieux que tout ce qui existe. Vous devez maintenant décider ce que vous allez en faire, car si vous êtes un laboratoire universitaire et que vous publiez avec, le monde viendra frapper à votre porte. Ne vous relâchez pas à la fin et décidez que 100 ml de surnageant suffiront pour durer éternellement - sauvez les clones et mettez-les dans une banque de cellules, ou essayez d'obtenir un accord de commercialisation avec une entreprise de fabrication afin que vous n'ayez pas à le faire. faire tout le travail !

J'espère que cela vous aidera, n'hésitez pas à me contacter si vous avez d'autres questions ou préoccupations.


Discussion

Le modulaire pOp6Le système inductible par les glucocorticoïdes /LhGR rapporté ici permet une induction efficace et robuste de l'expression du transgène dans le riz (Figs. 2, 5, 6, 7, 8). Le système est très sensible, répondant aux concentrations nanomolaires de DEX (Fig. 5), et se prête à différentes méthodes d'application de DEX pour répondre à différents objectifs. Par exemple, des tissus détachés (comme sur la figure 2) pourraient être utilisés pour cribler des lignées T0 en régénération pour une induction efficace de l'expression du transgène, des tests de submersion (comme sur la figure 8) pourraient être utilisés pour identifier les cibles/effets immédiats en aval de l'activité génique induite. , et la croissance sur un milieu contenant 0,01 M de DEX (comme sur la figure 5) pourraient être utilisées pour analyser l'effet du gène induit sur le développement des racines. L'induction contrôlée de gènes au cours du développement des pousses sera cependant plus difficile, car les concentrations de DEX nécessaires pour induire la pOp6 promoteur dans la pousse, inhibe la croissance lorsqu'il est inclus dans le milieu de culture (Figs. 3, 4 & Fig. 6). Bien que l'inclusion d'IPTG dans le milieu de culture améliore les effets toxiques de LhGR (Figs. 4 et 6), les concentrations relatives de DEX par rapport à IPTG devront être calibrées pour chaque lignée transgénique afin de maximiser l'expression du transgène et de minimiser les défauts de croissance. C'est-à-dire, pour éteindre la liaison LhGR induite par DEX à lacO-like sites dans le génome du riz, tout en permettant une liaison efficace au pOp6 promoteur dans le transgène. De manière cruciale, très peu d'expression a été vue de la part des pOp6 promoteur en l'absence d'inducteur, ce qui permettra à des transgènes potentiellement mortels d'être transportés par régénération des plantes T0, assurant une récolte réussie de graines transgéniques T1.

Les défauts sévères observés sur le riz pOp6Les lignées transgéniques /LhGR après croissance sur 10 M de DEX étaient inattendues, car des concentrations similaires du stéroïde ne sont pas signalées comme ayant un effet dans pOp6/LhGR de tabac ou d'Arabidopsis [5, 6]. En effet, le pOp6Le système /LhGR a d'abord été développé pour surmonter le problème que le système existant inductible par DEX, qui utilisait l'activateur transcriptionnel GVG avec le parent GAL4 promoteur [23], a fréquemment conduit à des défauts de croissance chez Arabidopsis, le riz et Lotus Japonicus [8, 14, 15]. Bien que la base moléculaire de ces défauts de croissance n'ait pas été établie, il a été suggéré que l'activateur de GVG se liait à des éléments régulateurs cis dans le génome de la plante qui avaient une homologie de séquence avec GAL4 [15]. L'activateur GVG comprend le domaine de liaison à l'ADN du facteur de transcription GAL4 de levure, le domaine d'activation de la protéine virale de l'herpès VP16 et le même domaine GR que dans LhGR [23]. L'inhibiteur de Gal80 pourrait éventuellement être utilisé pour titrer la liaison GAL4 hors cible [24] de la même manière que l'IPTG a été utilisé ici comme antagoniste efficace pour la LacI domaine de liaison à l'ADN dans LhGR (Figs. 4, 6), mais le Gal80 le gène devrait être co-exprimé in planta et l'activité peut être difficile à moduler. Les pOp6/Le système LhGR rapporté ici est donc actuellement le meilleur choix pour une utilisation dans le riz, avec la mise en garde que les effets phénotypiques de l'expression génique induite doivent être distingués des effets non spécifiques de LhGR, par comparaison avec des lignées de contrôle qui ont des niveaux similaires d'expression de LhGR mais aucun gène d'intérêt en aval de pOp6.

En raison de la stratégie de clonage modulaire du Golden Gate qui a été utilisée pour générer le pOp6/LhGR rapportées ici, il est possible de modifier facilement le système pour une optimisation supplémentaire. Par exemple, plusieurs gènes d'intérêt pourraient être induits simultanément avec un seul module LhGR et/ou des promoteurs spécifiques aux tissus pourraient être ajoutés pour contrôler spatialement l'activité de LhGR. Dans tous les cas, des précautions doivent être prises lors de l'introduction d'introns dans des constructions, car les séquences régulatrices qu'elles contiennent peuvent améliorer l'expression des gènes avec et sans induction [25]. Une approche alternative serait de générer un système synthétique orthogonal au génome du riz et donc incapable d'être compromis par les effets hors cible de l'application de DEX. Dans un système synthétique, des activateurs transcriptionnels tels que les dTALE [26] seraient conçus pour lier des séquences de promoteurs uniques qui ne sont pas présentes dans le génome du riz, et l'activateur serait alors fusionné à la séquence GR utilisée ici. En effet, cette approche pourrait être utilisée pour concevoir un système orthogonal pour n'importe quelle espèce de choix.


Résultats

Commutation d'isotype CH1 de FabA muqueux en FabG

Pour évaluer le rôle du domaine CH1 dans la spécificité et la fonction des Ab muqueux, deux clones FabA, à savoir 43 et 177, ont été étudiés. Ces FabA ont été obtenues précédemment [3] par criblage d'une banque de FabA HESN sur la région étendue proximale de la membrane du clade B gp41 (MPER) P1 [19,20] ou sur le clade B recombinant gp41 délété pour son MPER [3], respectivement. Au niveau moléculaire, FabA 43 a un degré élevé de mutations somatiques, une origine germinale de chaîne lourde VH3 similaire à la bNAb IgG 10E8 [21], et une longue CDRH3 de 22 résidus, présente des caractéristiques d'autres bNAb IgG [3]. En revanche, FabA 177 a un faible niveau de mutations somatiques dans la chaîne lourde, 100 % d'homologie avec la région du gène de la lignée germinale IGKVID-30*-01 et un CDRH3 de longueur normale de 11 résidus [3]. De plus, la chaîne lourde FabA 177 est issue de la famille VH6, une origine germinale jamais associée aux IgG bNAb. Chaque FabA a été transformé en FabG correspondant par génie génétique, remplaçant le CH1α1 par un CH1γ1, et purifié par chromatographie d'affinité, comme décrit dans la section Matériel et Méthodes. Dans chaque paire, les isotypes partagent des domaines VH et VL identiques et la même chaîne légère, différant uniquement par le domaine CH1.

Liaison FabA et FabG et affinité pour l'enveloppe du VIH-1

Nous avons d'abord évalué si la commutation de classe préserve les propriétés de liaison originales de l'IgA en comparant la liaison de FabA et de FabG à la gp41 trimère recombinante dérivée du clade B du VIH-1 [20] et à la gp140 dérivée des clades A et C du VIH-1, les trois principaux -1 clades répandu dans le monde. Pour éviter les biais introduits par différents anticorps spécifiques d'isotypes utilisés pour la détection, la liaison à la gp41 en ELISA a été révélée en utilisant la chaîne légère kappa anti-humaine de souris [12]. Les FabA 43 et 177 reconnaissent les régions conformationnellement conservées sur le clade B gp41 des virus tropiques R5 et X4 [12]. Nous avons constaté que les paires FabA et G se lient spécifiquement au clade B gp41 ainsi qu'aux clades A et C gp140 de manière dose-dépendante, mais de manière frappante pour tous les clades, la liaison de FabA 43 et 177 est plus efficace que celle de leur FabG respectif (figures 1A et 1B). Par conséquent, une concentration 50 fois plus élevée de FabG 43 (50 g/ml) est nécessaire pour atteindre la même liaison de gp41 de clade B de FabA 43 (1 g/ml) (figure 1A). Les différences observées entre FabA et G177 sont encore plus importantes, atteignant 500 fois entre les isotypes en faveur de FabA (Fig 1B). De même, la liaison à une quantité constante de gpl40 de clade A et C, nécessitait un FabA 43 10 fois moins que FabG 43 (figure 1A) et un FabA 177 50-100 fois moins que FabG 177 (figure 1B), respectivement. Les Fab-IgA D1.3 spécifiques du lysozyme [3] et les Fab-IgG non pertinents utilisés comme contrôle négatif ne reconnaissent aucun des clade B gp41 ou des clade A et C gp140.

FabA et G des clones 43 et 177 se liant aux clades A, B et C de l'enveloppe du VIH gp41 de manière dose-dépendante. A et B: La spécificité de FabA (trait plein) et FabG (trait pointillé) pour le clade A gp140 (rouge), le clade B gp41 (bleu) le clade C gp41 (vert) a été évaluée par ELISA. Pour une comparaison directe des isotypes FabA et G, la détection a été effectuée en utilisant une chaîne légère anti-kappa. La liaison spécifique (DO450 nm) est tracée en fonction de la concentration en Fab (μg/ml). Les valeurs représentent la moyenne ± SEM, dérivée de 3 expériences indépendantes réalisées en double. (UNE) Fab 43, (B) Fab 177. C: La spécificité de FabA 43 (trait plein) et FabG 43 (trait pointillé) pour le clade croisé du peptide P1, à savoir le clade A (rouge), le clade B (bleu) et le clade C (vert) a été évaluée par ELISA. Un représentant sur trois expériences indépendantes réalisées en double est montré. D et E : Liaison de FabA et G des clones 43 et 177 à VIH-1 infecté CD4 + lymphocytes T. FabA (barres pleines) et FabG (barres hachurées) des clones 43 () et 177 (E) ont été incubés avec des cellules infectées par le VIH ou des cellules non infectées du clade A (rouge) ou du clade B (bleu) et du clade C (vert) comme contrôle négatif pendant une nuit à 4 °C. Des IgA et IgG non pertinents ont été utilisés comme témoins négatifs. Une liaison spécifique a été détectée à l'aide de la chaîne légère kappa anti-humaine conjuguée au FITC pour permettre une comparaison directe des isotypes FabA et G, et analysée par cytométrie en flux, comme indiqué dans la section Matériaux et méthodes. Les valeurs représentent le % de Fab+± SEM parmi les lymphocytes T CD4+ infectés par le VIH-1 (Gag-p24+). La liaison de tous les Fab aux cellules non infectées était négligeable. La liaison des IgA et IgG non pertinentes aux cellules infectées a été fixée à 1 % et soustraite des valeurs de liaison spécifiques n = 3 expériences indépendantes. Test t de Student, * = p<0,05.

Ensuite, la résonance plasmonique de surface (SPR) a été utilisée dans des expériences cinétiques pour comparer l'affinité FabA et G au clade B gp41, clade A ou C gp140 immobilisé sur la surface de la puce du capteur. FabA et FabG 43 et 177 à diverses concentrations, étaient les analytes. En conséquence (tableau 1 et S1 Fig), lorsque le clade B gp41 sert de cible, KD est de 3,62 nM pour FabA 43 et de 21,2 nM pour FabA 177 contre 1,12 et 1,22 M pour leur FabG respectif. Lorsque les clade A et C gp140 servent de cible, les KD sont de 6,41 et 4,79 nM pour le FabA 43 contre 500 nM, et aucune affinité n'est mesurée pour le FabG 43 apparié. KD est égal à 0,29 et 21,5 nM pour le FabA 177, alors que le FabG 177 apparié n'a aucune affinité mesurable pour les enveloppes virales du clade A ou C.

Globalement, les affinités pour les enveloppes VIH de tous les clades atteignent la gamme nM pour les clones FabA 43 et 177, similaire à celle des autres bNAbs [22], alors qu'elle reste de l'ordre du M voire inférieure pour le FabG correspondant, en accord avec expériences de liaison utilisant ELISA (Fig 1). Fait important, pour tous les Fab pris ensemble, l'affinité est en corrélation avec la liaison observée par ELISA (spearman r = 0,606 p = 0,0375)

Liaison de FabA et FabG au peptide P1

Le peptide P1 de 35 acides aminés a été caractérisé comme la région externe proximale de la membrane minimale de l'enveloppe virale, gp41, qui permet la liaison du VIH-1 au galactosylcéramide, le récepteur muqueux du VIH-1 et pour l'entrée muqueuse du VIH-1 par transcytose [23 –25]. Cette région hautement conservée a été utilisée comme immunogène dans un vaccin prophylactique contre le VIH-1 à la fois dans des essais précliniques et cliniques de phase I [20,26]. La séquence P1 est bien conservée entre les virus du clade B et A alors qu'une mutation K670S dans le virus du clade C empêche la liaison de l'IgG bNAb 2F5 [27]. FabA 43 a été obtenu en criblant la bibliothèque FabA HESN sur le clade B P1 et par conséquent FabA 43 se lie au clade B P1 [3]. Lorsqu'elle est étudiée par RMN, la structure tridimensionnelle P1 n'est pas linéaire mais contient 2 hélices séparées par un coude [28]. Nous avons ainsi évalué par ELISA, la capacité de FabA et G 43 à se lier aux clade A, B et C P1, comparativement comme décrit [3]. Les isotypes FabA et G 43 se lient aux clades A, B et C P1 de manière dose-dépendante (Fig 1C). De manière frappante comme ci-dessus, lorsque le peptide P1 est exprimé dans le contexte d'une protéine complète (figure 1A), FabA 43 reconnaît P1 plus efficacement que son FabG correspondant (figure 1C). Cette différence est plus élevée lorsque le clade B P1 est la cible (avec un changement de 60 fois de FabA à G), mais toujours significative (avec un changement de 20 fois de FabA à G) lorsque les clade A et C sont des cibles (Fig 1C) . De plus, FabA et FabG 43 se lient plus efficacement au clade B par rapport au clade A et C P1 (figure 1C). Ces différences dans la liaison de l'isotype Fab à P1 des trois clades sont également observées par SPR (S2 Fig).

Dans l'ensemble, le FabA 43 lie le clade croisé de la sous-unité gp41 P1 plus efficacement que ses homologues FabG avec une affinité de l'ordre du nM.

FabA et FabG se liant aux lymphocytes T CD4 + infectés par le VIH

Nous avons ensuite évalué la capacité des Fabs à se lier à l'enveloppe virale dans sa conformation de pointe trimérique à la surface de lymphocytes T CD4+ infectés par le clade A (isolat primaire 92UG031), B (isolat JR-CSF) ou C (virus primaire isoler 92BR025). Après une nuit d'incubation à 4°C avec les divers Fab, la liaison a été évaluée par cytométrie de flux en utilisant un anticorps secondaire anti-chaîne légère kappa pour permettre une comparaison isotypique directe. Tous les Fab se lient spécifiquement aux cellules infectées par le VIH-1 bien que la liaison des FabG aux cellules infectées par le VIH-1 du clade C et du clade A soit beaucoup plus faible par rapport aux FabA. Entre 20 et 40 % des lymphocytes T infectés par le VIH marqués pour FabA contre 5 et 19 % pour FabG (Student’s t–test, p<0.05) (Fig 1D et 1E). FabA 43 reconnaît plus efficacement le clade A- que les cellules T CD4 + infectées par le clade B et C (figure 1D), alors qu'aucune différence n'était apparente entre les clades pour FabA 177 (figure 1E). Il est important de noter que la liaison de Fab aux cellules infectées par le VIH-1 est en corrélation avec l'affinité de Fab et la liaison à l'enveloppe du VIH-1 mesurée par ELISA (figure 1A-1C) (spearman r = 0,777 p = 0,0156) (figure 2F).

Efficacité antivirale des Fab 43 et 177-A et -G contre les clades A, B et C du VIH-1. (UNE et B) Inhibition dose-dépendante de l'infection par le VIH-1 médiée par Fab 43 (UNE) et Fab 177 (B) évaluée dans un test d'infectivité à cycle unique, en utilisant la coloration p24 sur des lymphocytes T CD4 +. Pour chaque clone Fab, FabA (ligne continue) et FabG (ligne pointillée) ont été incubés pendant 1 h à 37 °C avec le clade A du VIH-1 (rouge), le clade B (bleu) ou avec le clade C (vert) avant l'ajout de cellules CD4 + T pendant 36 h. Des Fab-IgA non pertinents (ligne grise continue) et des Fab-IgG (ligne grise en pointillés) à des concentrations similaires ont été utilisés comme témoins négatifs. Le pourcentage de neutralisation, analysé par cytométrie en flux comme indiqué dans la section Matériels et méthodes, a été défini comme la réduction des cellules infectées par Gag-p24 + VIH-1 par rapport aux cellules infectées par VIH-1 en l'absence de Fab. Les valeurs représentent la moyenne ± SEM, dérivée d'au moins 4 expériences indépendantes réalisées en triple. Test t de Student, * = p<0.01 ** = p<0.001 *** = p<0.00001. (C et ) Inhibition du transfert du VIH-1 des CL vers les cellules CD4 + T autologues évaluée en mesurant la p24 libérée par les co-cultures de cellules CL/T au jour 5. VIH-1 du clade A (rouge), du clade B (bleu) ou Le clade C (vert) a été pré-incubé avec des LC pendant 2 h avant l'ajout des Fab (ligne continue FabA, ligne pointillée FabG) et des lymphocytes T CD4+. Des Fab-IgA non pertinents (ligne grise continue) et des Fab-IgG (ligne grise en pointillés) à des concentrations similaires ont été utilisés comme témoins négatifs. Les cocultures de cellules LC-T ont été incubées à 37°C pendant 7 jours. Les cocultures LC-T sans Fab ont été considérées comme un transfert à 100 % du VIH-1 de la LC aux cellules T CD4+ autologues. Le transfert de virus a été évalué en mesurant le p24-Ag par ELISA comme décrit dans la section Matériel et méthodes. Les résultats correspondent au % d'inhibition de transfert en présence de Fab. Les valeurs représentent la moyenne ± SEM d'au moins cinq expériences indépendantes réalisées en triple. Test t de Student, * = p<0.01** = p<0.01. (E) Corrélation entre l'activité neutralisante du VIH-1 et l'inhibition du transfert. La neutralisation et l'inhibition de transfert mesurées pour les clones 43 et 177 FabA et G à 100ng/ml, étaient corrélées. La corrélation de rang de Spearman r et les valeurs correspondantes sont indiquées. (F) Corrélation entre les performances dans chaque essai de chaque clone 43 et 177. Le rapport des valeurs obtenues dans chaque dosage indiqué pour les FabA et G appariés de chaque clone a été obtenu et tracé sous forme de carte thermique en utilisant la méthode de regroupement de liaisons complètes et le classement selon les statistiques de Spearman. La liaison représente 1/valeurs de DO ELISA d'enveloppe du VIH. L'affinité correspond aux valeurs 1/log KD.

Propriétés antivirales FabA et FabG

Neutralisation de l'infection par les lymphocytes T CD4+ du VIH-1 par FabA et FabG.

Comme FabA et G ne diffèrent que par le domaine CH1, les résultats présentés ci-dessus suggèrent que le domaine CH1 affecte l'ajustement du paratope sur l'antigène qui pourrait, à son tour, avoir un impact sur la fonction antivirale Ab d'une manière isotype-dépendante.

Therefore, we first investigated the impact of the CH1 isotype in Fab-neutralizing activities. Using a panel of three viruses from clade A, B and C, neutralization of CD4 + T lymphocytes infection by both FabA and G pairs was tested as previously described [3]. Serial dilutions of each FabA and G were assessed comparatively, and IC50 values were determined for each HIV-1 clade. Comparative evaluation of paired Fab 43 isotypes reveals that FaA 43 neutralizes all three A, B and C clades with a respective IC50 of 1ng, 1μg and 100ng/ml, whereas FabG 43 only neutralizes clade A virus with an IC50 of 100ng/ml but not clades B or C virus (Fig 2A). A similar neutralization pattern is observed for the clone 177 with an IC50 of 1ng, 300ng and 30ng/ml for FabA 177 against clade A, B and C virus respectively and an IC50 of 100ng and 1μg for FabG 177 against clade A and C virus, respectively (Fig 2B). In all cases, the paired FabA has significantly-increased neutralization compared to its paired FabG for all concentrations evaluated (Student’s t–test, p values ranging from p<0.01 to p<0.00001). Irrelevant Fab-IgA and Fab-IgG, used as negative controls in parallel experiments lack neutralizing. Of note, cross-neutralization of the Fab we report is based on only one isolate of each clade and should be confirmed on more isolate per clade in future studies.

In summary, for all three HIV-1 clades tested, the CH1α confers to FabA the capacity to neutralize CD4 + T-cell infection whereas the corresponding FabG harboring the same paratope but a different CH1, namely CH1γ, has limited neutralizing activities.

Blockade of cell-to-cell virus transfer by FabA and FabG.

Cell-to-cell transmission of HIV-1 is of major importance in vivo, being much more efficient than infection by cell-free virions [29]. At the mucosal level, HIV-1 entry through multilayer mucosal tissues occurs mainly by targeting Langerhans cells (LCs) that in turn, transfer to CD4 + T-cells [30–33], which constitute the founder-infected cell population. In turn, CD4 + T-cells migrate out of the mucosal tissue, further spreading the virus. Thus, we evaluated the capacity of both pairs of HESN Fabs to block clades A, B and C virus transfer from LCs to CD4 + T-cells. Transfer of clade A and C HIV-1 is inhibited by both FabA 43 and 177 in a concentration-dependent manner, as well as that of clade B by FabA 43, inducing a >40% inhibition at 100ng/ml. Transfer of clade B virus remains much less sensitive to FabA 177 (Fig 2C and 2D). FabG 43 blocks transfer of clade A and C viruses but less efficiently than its FabA counterpart (Fig 2C), and FabG 177 was only able to block clade A HIV-1 transfer (Fig 2D). Irrelevant Fab-IgA and Fab-IgG, used as negative controls, fail to interfere with HIV-1 transfer from LCs to CD4 + T cells.

Of note, taking all the values into consideration (including all viral clades and Fab isotypes) together, at 100ng/ml of Fab, neutralization capacity correlated directly with inhibition of virus transfer (spearman r = 0.6655, p = 0.0219) (Fig 2E).

Taken together, this series of functional analyses demonstrates that switching the CH1α from a mucosal Ab to CH1γ, considerably reduces the Fab antiviral properties, namely both neutralization and HIV-1 transfer from LCs to CD4 + T-cells (Fig 2F).

Identification of FabA- and G-specific mimotopes

The molecular basis by which the CH1 region impacts antibody affinity and functions, could be due to selective molecular stringency/flexibility imposed by the CH1 domain on the paratope conformation. Thus, we aimed to determine the conformational epitopes specific for each Fab isotype, namely clones 43- and 177-specific FabA and FabG.

Consequently, a 12 mer random peptide library was used to characterize a set of the best specific peptides, referred to as mimotopes, of both 43 and 177 clones as FabA and FabG using three rounds of successive screening with increasing stringency, as we have previously described [12]. After sequencing 100 phages specific for each of the Fabs, none of the selected mimotopes correspond to linear sequences of gp41, indicating that Fab epitopes are conformational, as already suggested [3]. Whereas a larger set of mimotopes with high occurrence were retrieved on each of the FabA, a limited number of different phage-expressing peptides bound to FabG, in line with the lower affinity of the FabGs compared with FabAs for gp41 (S1 and S2 Tables).

Conformational FabA and G epitope mapping

The strategy we used to characterize conformational epitopes corresponding to each set of mimotopes, using in silico approaches, is based on mimotope mapping onto trimeric gp41 crystal structures, as described in the Material and Methods section and supplementary data. When experimental techniques such as X-ray crystallography of antibody-antigen interactions turn difficult to use [34], such as in the present case, and when the structure of the target is known, in silico approaches can provide an appropriate means to identify candidate epitopes to be further tested [35], for instance by competition experiments. Only two gp41 crystal structures of a clade B, but not clade A or C gp41, each in a different conformational state, are available. One structure represents gp41 in the pre-fusion state, together with gp120, although this gp41 lacks the MPER region [36]. The other gp41 structure mimics the 6-Helix bundle state and is composed of three N-helices and three C-helices that form a six helix-bundle for completion of HIV-1 fusion with target cells in a “spring-loaded” model of fusion. In this case, the gp41 construct lacks the gp41 Cys-loop bridging the C and N helices [37].

As Fab 43 is primarily specific for the gp41 MPER [3] and the Cys-loop contains important gp41 epitopes [38], we reconstructed in silico the missing parts of clade B gp41 as described in the Material and Methods section using our recently-developed approach [39]. Hence, we first optimized the available crystal structure of gp41 clade B by reconstituting the missing MPER in the pre-fusion structure and the missing loop in the 6-Helix bundle as described in the supplementary data.

Furthermore, as no crystal structures of clade A or C are available in the literature, we constructed clade A and clade C gp41 structures by mapping each of clade A and clade C gp41 sequences onto the clade B gp41 structures, as detailed in the supplementary data. As a result, from these in silico modeling calculations, simulation of clade A, B and C gp41 structures in the pre-fusion and 6-Helix bundle conformations were available for epitope mapping studies.

Selected FabA-specific mimotopes, obtained from FabA 43 and 177, were localized on clade A, B and C gp41 pre-fusion and 6-helix bundle structures, using the PEPsurf method as detailed in supplementary S3 Fig. Two main regions are targeted by FabA 43 mimotopes on gp41 6-helix bundle structure of all three clades, the highest hits being localized on the lower MPER region interface with the N-helix (Fig 3A), in agreement with the screening strategy focusing on P1, used for selecting FabA 43 [3]. In comparison, FabA 43 mimotopes only fit on the clade B pre-fusion structures and with lower scores (Fig 4A). Furthermore, mimotopes fit on each gp41 with slight differences as recapitulated in S3 Table.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (UNE) and 177 (B) were docked on the crystal structure of gp41 under its 6-Helix bundle conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized in a color scale according to the scores returned by the PEPsurf algorithm at each position of the sequence (mean of the 3 chains, over 15 conformations extracted each 10 ns from the molecular dynamic simulations) for each set of mimotope. A common color scale varying from never (yellow) to the most frequent on all clades and structures (red) is used, allowing to directly compare epitopes on the three gp41 clades. For each score, a set of random sequences at each position of the sequence had been subtracted to remove background noise.

Each set of antibody specific mimotopes obtained by biopanning for both isotype FabA clones 43 (UNE) and 177 (B) were docked on the crystal structure of gp41 under its trimeric pre-fusion conformation. Each gp41 monomer in the trimer is highlighted by a different hue of blue. Epitopes are visualized as described in Fig 3 using the same scale to facilitate direct comparison.

The main region targeted by FabA 177 mimotopes on gp41 6-helix bundle structures of all three clades, differs from those targeted by FabA 43 mimotopes, as expected [3]. FabA 177 mimotopes best fit the loop linking the N and C gp41-helices (Fig 3B). These FabA 177-specific mimotopes target an additional domain overlapping the regions mapped by FabA 43 mimotopes, although identified with a much lower score that might not be biologically relevant. Finally, these FabA 177 mimotopes also match gp41 pre-fusion structures as detailed in S2 Table, but with lower scores than the 6-Helix bundle and in a more scattered pattern, irrespective of the clade (Fig 4B) and thus with limited biological relevance.

When FabG sets of specific mimotopes were analyzed similarly, numerous regions were targeted on the various gp41 structures. Corresponding scores might not be relevant biologically, in agreement with the low affinity of FabGs for gp41 and the low number of mimotopes retrieved compared to FabAs. We therefore concentrated our analysis on the FabA 43 and 177 mimotopes.

Design of peptides recapitulating FabA conformational epitopes

To validate experimentally, the FabA conformational epitopes defined in silico as described above, we designed peptides that mimic each conformational FabA epitope and evaluated their capacity to bind their corresponding FabA. To construct these peptides, additional bioinformatic analyses were conducted for each mimotope independently as described in the Material and Methods section.

From these analyses, five peptides specific for FabA 43, namely P7 to P11 could be designed (S4 Table). All of these Fab43 specific peptides appear compatible with the 3-dimensional 6-Helix bundle conformations in all three clades, except P8 which targets only the clade A pre-fusion conformation.

When tested at the biological level for FabA specificity, one out of the five conformational epitopes defined in silico for FabA 43, encompassing regions on both the gp41 N and C-Helixes with LWNWFDISAASI as sequence, and referred to as P7, competes significantly with FabA 43 binding to P1 and gp41/gp140 of the three clades in ELISA when preincubated with the FabA 43 (Figs 5A and S3A) in a concentration-dependent manner (Fig 5B). P7 at 5 μM blocks FabA 43 binding by >50%, reaching >80% at 10μM (Fig 5B). A 9 amino acid peptide derived from the influenza virus hemagglutinin (HA) used as negative control, does not interfere with FabA 43 binding in ELISA (Fig 5A). In contrast, peptide P7 does not interfere with FabG 43 binding to the same antigens (not shown). Taken together, these results indicate that P7 interferes with FabA 43 cross-clade.

(UNE) Preincubation of FabA 43 with the conformational epitope P7 (5 μM, hatch bars) but not with control HA (5μM, plain bars) interferes significantly with FabA 43 binding to clade A (red), clade B (blue) and clade C (green) P1 of clades A and C gp140 and clade B gp41, as evaluated by competition ELISA as described in Material and Method section. FabA 43 preincubated with P7 or control HA were added to gp41 clade B, gp140 (clades A, C) or P1 (clades A, B, C) coated on the ELISA and their binding was detected by using HRP-coupled anti-human IgA. The percentage of binding was calculated relative to the binding of Fab in the absence of the P7 or control HA. (B) The P7-induced reduction of FabA 43 binding to each antigen is dose dependent. Competition ELISA was done in the same conditions described in A. Binding inhibition to FabA 43 binding to each antigen in the presence of P7 is calculated relative to the binding inhibition in the presence of the irrelevant HA peptide serving as negative control. In A and B, values represent mean ± SEM, derived from 3 independent experiments performed in triplicate. (C) Localization of the amino acid paths corresponding to P7 peptide on the 6-Helix bundle conformation of clades A, B and C gp41 frame15. Each gp41 monomer of the trimer is depicted using a different level of gray. The amino acid paths corresponding to the FaA 43-specific peptide P7 are highlighted in orange. Note residues 532–535 belong to the N-Helix of one monomer while residues 669–672 belong to the C-Helix of another monomer of the trimer. Red: the P7-predicted conformation, superimposed on the structure of gp41. RMSD values over the paired residues of gp41 and P7 are of 2.45, 2.97 and 1.97 Å for clade A, B and C, respectively. Note that in this region of the gp41, only residue 535 differs between clade B in one hand and clade A and C in the other hand. () Conformational variability of the predicted conformations of P7 using PEP-FOLD3. Left: conformation best fitting gp41. Right: top 10 predicted conformations superimposed. (E) Interference of FabA 43 neutralization by a 400-fold molar excess of P7 peptide. FabA 43 preincubated with P7 or control HA were incubated with the HIV-1 of one of each three clades (A, B, C) before adding the activated CD4 + T cells, and cultures were incubated at 37°C for 2 days. Cultures without Fab were served as positive control of infection. The percentage of neutralization, analyzed by flow cytometry as indicated in Materials and Methods section, is shown relative to FabA 43 neutralization using primary CD4 + T cells in the presence of the irrelevant HA peptide, tested in parallel. Values represent mean ± SEM, derived from 3 independent experiments performed in triplicate.

The 12 aminoacid peptide P7 recapitulates a region located at the interface formed by the tips of N- and C-helix of the three clades of gp41 (Fig 5C and 5D). Although P7 has been defined as the best conformational epitope extracted by in silico analyses from FabA 43 mimotope fitting to the 6-Helix bundle clade A gp41 structure, this cross-clade reactivity is expected. Hence, the P7- corresponding region in clade B and C is similar in sequence, although it harbors a I535M substitution in clade B. Our predictions support the hypothesis that P7 mimics a patch on gp41 surface involving two different monomers of the gp41 6-Helix bundle, suggesting that FaA 43 could freeze gp41 in the 6-Helix bundle conformation, thereby preventing further conformational changes of the trimer assembly. The other four conformational peptides defined in silico for FabA 43 that do not interfere with FabA 43 binding to the gp41 antigens are located on different regions of gp41, regardless of the gp41 clade. As two of them are spatially close from the region defined by P7 (S4 Fig), it suggests that the region mapped by P7 on gp41 is highly specific for FabA 43 binding to the HIV-1 envelope. Furthermore, at the functional level, preincubation of FabA 43 with a 400- fold molar excess of P7 blocked the FabA 43 HIV-1 clades A, B and C neutralizing activities with an efficacy of 33±5, 54±8, and 24±11%, respectively (Fig 5E). These results are in good agreement with the antigen-binding blockade observed in ELISA (Fig 5A and 5B).

Finally, six conformational epitopes, referred to as P0 to P6, that best mimic each set of mimotopes specific for FabA 177, were also designed for each gp41 conformation and clade (S2 and S3 Tables). The six peptides extracted from this analysis are compatible with the 3D conformations of at least two clades and interfere all, although to different degrees, with FabA 177 binding to gp41/gp140 of clades A, B and C, with a maximal binding inhibition limited to 23% (S3B Fig). However, no interference was observed with FabA 177 neutralizing activity against HIV-1 of clades A, B and C.


16.3 Systèmes circulatoire et respiratoire

Les animaux sont des organismes multicellulaires complexes qui nécessitent un mécanisme pour transporter les nutriments dans tout leur corps et éliminer les déchets. Le système circulatoire humain possède un réseau complexe de vaisseaux sanguins qui atteignent toutes les parties du corps. Ce vaste réseau alimente les cellules, les tissus et les organes en oxygène et en nutriments, et élimine le dioxyde de carbone et les déchets.

Le moyen de transport des gaz et autres molécules est le sang, qui circule continuellement dans le système. Les différences de pression dans le système provoquent le mouvement du sang et sont créées par le pompage du cœur.

Les échanges gazeux entre les tissus et le sang sont une fonction essentielle du système circulatoire. Chez les humains, les autres mammifères et les oiseaux, le sang absorbe l'oxygène et libère du dioxyde de carbone dans les poumons. Ainsi, les systèmes circulatoire et respiratoire, dont la fonction est d'obtenir de l'oxygène et de rejeter du dioxyde de carbone, fonctionnent en tandem.

Le système respiratoire

Inspirez et retenez-le. Attendez quelques secondes puis laissez-le sortir. Les humains, lorsqu'ils ne font pas d'efforts, respirent environ 15 fois par minute en moyenne. Cela équivaut à environ 900 respirations par heure ou 21 600 respirations par jour. À chaque inspiration, l'air remplit les poumons et à chaque expiration, il ressort. Cet air fait plus que simplement gonfler et dégonfler les poumons dans la cavité thoracique. L'air contient de l'oxygène qui traverse le tissu pulmonaire, pénètre dans la circulation sanguine et se rend aux organes et aux tissus. Là, l'oxygène est échangé contre du dioxyde de carbone, qui est un déchet cellulaire. Le dioxyde de carbone sort des cellules, pénètre dans la circulation sanguine, retourne dans les poumons et est expiré hors du corps pendant l'expiration.

La respiration est à la fois un événement volontaire et involontaire. La fréquence à laquelle une respiration est prise et la quantité d'air inhalée ou expirée sont régulées par le centre respiratoire du cerveau en réponse aux signaux qu'il reçoit concernant la teneur en dioxyde de carbone du sang. Cependant, il est possible de passer outre cette régulation automatique pour des activités telles que parler, chanter et nager sous l'eau.

Pendant l'inspiration, le diaphragme descend en créant une pression négative autour des poumons et ils commencent à se gonfler, aspirant l'air de l'extérieur du corps. L'air pénètre dans le corps par la cavité nasale située juste à l'intérieur du nez (Figure 16.9). Lorsque l'air traverse la cavité nasale, l'air est réchauffé à la température du corps et humidifié par l'humidité des muqueuses. Ces processus aident à équilibrer l'air par rapport aux conditions corporelles, réduisant ainsi les dommages que l'air froid et sec peut causer. Les particules qui flottent dans l'air sont éliminées dans les voies nasales par les poils, le mucus et les cils. L'air est également échantillonné chimiquement par l'odorat.

De la cavité nasale, l'air passe par le pharynx (gorge) et le larynx (boîte vocale) alors qu'il se dirige vers la trachée (Figure 16.9). La fonction principale de la trachée est de canaliser l'air inhalé vers les poumons et l'air expiré hors du corps. La trachée humaine est un cylindre d'environ 25 à 30 cm (9,8 à 11,8 pouces) de long, qui se trouve devant l'œsophage et s'étend du pharynx à la cavité thoracique jusqu'aux poumons. Il est composé d'anneaux incomplets de cartilage et de muscle lisse. Le cartilage fournit force et soutien à la trachée pour maintenir le passage ouvert. La trachée est tapissée de cellules qui ont des cils et sécrètent du mucus. Le mucus attrape les particules qui ont été inhalées et les cils déplacent les particules vers le pharynx.

L'extrémité de la trachée se divise en deux bronches qui pénètrent dans les poumons droit et gauche. L'air pénètre dans les poumons par les bronches primaires. La bronche primaire se divise, créant des bronches de diamètre de plus en plus petit jusqu'à ce que les passages aient un diamètre inférieur à 1 mm (0,03 in) lorsqu'elles sont appelées bronchioles lorsqu'elles se divisent et se propagent dans les poumons. Comme la trachée, les bronches et les bronchioles sont constituées de cartilage et de muscle lisse. Les bronches sont innervées par les nerfs des systèmes nerveux parasympathique et sympathique qui contrôlent la contraction musculaire (parasympathique) ou la relaxation (sympathique) dans les bronches et les bronchioles, selon les signaux du système nerveux. Les bronchioles finales sont les bronchioles respiratoires. Des canaux alvéolaires sont attachés à l'extrémité de chaque bronchiole respiratoire. Au bout de chaque canal se trouvent des sacs alvéolaires contenant chacun 20 à 30 alvéoles. Les échanges gazeux ne se produisent que dans les alvéoles. Les alvéoles sont à parois minces et ressemblent à de minuscules bulles à l'intérieur des sacs. Les alvéoles sont en contact direct avec les capillaires du système circulatoire. Un tel contact intime garantit que l'oxygène se diffusera des alvéoles dans le sang. De plus, le dioxyde de carbone diffusera du sang dans les alvéoles pour être expiré. La disposition anatomique des capillaires et des alvéoles met l'accent sur la relation structurelle et fonctionnelle des systèmes respiratoire et circulatoire. Les estimations de la surface des alvéoles pulmonaires varient autour de 100 m 2 . Cette grande surface est à peu près la superficie d'un demi-terrain de tennis. Cette grande surface, combinée à la nature à paroi mince des cellules alvéolaires, permet aux gaz de se diffuser facilement à travers les cellules.

Connexion visuelle

Laquelle des affirmations suivantes concernant le système respiratoire humain est fausse ?


Investigations into the Biosynthesis, Regulation, and Self-Resistance of Toxoflavin in Pseudomonas protegens Pf-5

Pseudomonas spp. are prolific producers of natural products from many structural classes. Here we show that the soil bacterium Pseudomonas protegens Pf-5 is capable of producing trace levels of the triazine natural product toxoflavin (1) under microaerobic conditions. We evaluated toxoflavin production by derivatives of Pf-5 with deletions in specific biosynthesis genes, which led us to propose a revised biosynthetic pathway for toxoflavin that shares the first two steps with riboflavin biosynthesis. We also report that toxM, which is not present in the well-characterized cluster of Burkholderia glumae, encodes a monooxygenase that degrades toxoflavin. The toxoflavin degradation product of ToxM is identical to that of TflA, the toxoflavin lyase from Paenibacillus polymyxa. Toxoflavin production by P. protegens causes inhibition of several plant-pathogenic bacteria, and introduction of toxM into the toxoflavin-sensitive strain Pseudomonas syringae DC3000 results in resistance to toxoflavin.

Mots clés: biocontrol natural products secondary metabolism triazine.


1 INTRODUCTION

Riz (Oryza sativa L.) is a widely consumed staple food feeding over half of population in the world, especially in Asia (Dong et al., ( 2018 )). During the past decades, China has successfully promoted the cultivation of hybrid rice by developing heterosis, which has greatly increased rice yield (Duan et al., 2013 ). In spite of this, developing high-yield new varieties remains one of the major problems concerning rice breeders due to the growing consumer demand, decreased arable land, and the gradually deteriorating environment. Except for yield, the improvement of grain quality and appearance are also important concerns in rice breeding (Peng et al., 2016 ). However, it is inefficient to select those traits based on direct field observation due to their complexity and vulnerability to environmental influences. For example, the rice yield trait depends on the synergy of various factors, including the spikelet number per panicle and panicles per plant, grain weight, grain filling, plant height, and panicle length (Duan, 2013 Shen et al., 2018 ), while the grain appearance quality is essentially determined by grain length, grain width, and grain density (Bazrkar-Khatibani et al., 2019 Lou et al., 2009 ). In recent years, the development of DNA markers and linkage maps enables the molecular breeding of rice to split complex polygenic traits into single Mendelian QTL (Lou et al., 2009 Zhang, Chen, et al., 2017 ).

The genotyping-by-sequencing (GBS) technology is a rapid, simple, and low-cost genotyping method based on the next-generation sequencing and has the capacity of identifying a number of DNA sequences near enzyme cleavage sites and single nucleotide polymorphism (SNP) information for a plant species (Elshire et al., 2012 ). It has been wildly used in the construction of the genetic map, the studies of animal/plant population evolution, and the auxiliary genome assembly (Poland & Rife, 2012 Pootakham et al., 2015 ). The high-throughput SNP genotyping method has also been wildly used in the QTL mapping marker-assisted breeding in rice (Angaji, 2009 Zhang et al., 2017 ). Tang and colleagues characterized the genome-wide SNPs of the parental varieties of recombinant inbred line (RIL) populations using the high-throughput GBS and identified a QTL containing the locus Os4g48460 (a putative cytochrome P450) related to rice seed size (Tang et al., 2016 ). Zhu performed QTL mapping in a restorer line of hybrid rice based on ultra-high-density SNP mapping and found 26 QTLs for six yield traits, in which nine QTL alleles presented a significant effect (Zhu et al., 2017 ). Jiang performed the high-density genetic map in the QTL mapping of 124 rice backcrossed recombinant inbred lines and showed six QTLs related to seed germination in response to the cold stress (Jiang et al., 2017 ).

In this study, the F8 recombinant inbred lines (RILs), developed from the cross Dexiang074B and Pujiang6, were used. Dexiang074B, as a high-combining ability hybrid rice maintainer line, is currently one of the rice backbone parents in Sichuan province and combines high grain quality and yield. Its hybrid progeny, Deyou 4727, passed the national examination and approval in 2014 and was named "green super rice" in 2019. As an indica three-line hybrid rice, this variety is widely planted in the upper and middle reaches of the Yangtze River. It has characteristics of large grains, high seed setting rate, high yield (rice yield is up to 15.0 t/ha), excellent rice quality, and moderate resistance to rice blast. Pujiang6, a farm variety with rounded grain appearance, displays great differences with the economic traits of Dexiang074B. To further understand the genetic basis of agricultural traits in the RILs of rice, including heading data, grain length, grain width, thousand kernel weight, grain density, panicle length, the panicle number, and plant height, we performed genome-wide SNP discovery and QTL mapping for the RIL (F8) population using high-density GBS-based SNP linkage mapping. A total of 426 additive QTLs were identified for the eight agricultural traits with different environments or methods. Importantly, 98 highly reliable QTLs can be detected repeatedly by multiple methods or multiple environments. This study provides a genetic basis for developing cultivated rice with economic characteristics based on the molecular breeding technology.


Contenu

JAK2 gene fusions with the TEL(ETV6) (TEL-JAK2) and PCM1 genes have been found in patients suffering leukemia, particularly clonal eosinophilia forms of the disease. [11] [12] [13]

Mutations in JAK2 have been implicated in polycythemia vera, essential thrombocythemia, and myelofibrosis as well as other myeloproliferative disorders. [14] This mutation (V617F), a change of valine to phenylalanine at the 617 position, appears to render hematopoietic cells more sensitive to growth factors such as erythropoietin and thrombopoietin, because the receptors for these growth factors require JAK2 for signal transduction. An inhibitor of JAK2-STAT5, AZD1480, was pointed as having activity in primary and CRPC. [15] Jak2 mutation, when demonstrable, is one of the methods of diagnosing polycythemia vera. [16]

Janus kinase 2 has been shown to interact with:

Prolactin signals through JAK2 are dependent on STAT5, and on the RUSH transcription factors. [60]


Contenu

Khorana was born to Krishna Devi Khorana and Ganpat Rai Khorana, in Raipur, a village in Multan, Punjab, British India in a Punjabi Hindu family. [9] The exact date of his birth is not certain but he believed that it might have been 9 January 1922 [10] this date was later shown in some documents, and has been widely accepted. [11] He was the youngest of five children. His father was a patwari, a village agricultural taxation clerk in the British Indian government. In his autobiography, Khorana wrote this summary: "Although poor, my father was dedicated to educating his children and we were practically the only literate family in the village inhabited by about 100 people." [12] The first four years of his education were provided under a tree, a spot that was, in effect, the only school in the village. [9]

He attended D.A.V. (Dayanand Anglo-Vedic) High School in Multan, in West Punjab. [9] Later, he studied at the Punjab University in Lahore, with the assistance of scholarships, where he obtained a bachelor's degree in 1943 [12] and a Master of Science degree in 1945. [4] [13]

Khorana lived in British India until 1945, when he moved to England to study organic chemistry at the University of Liverpool on a Government of India Fellowship. He received his PhD in 1948 advised by Roger J. S. Beer. [14] [15] [16] [12] The following year, he pursued postdoctoral studies with Professor Vladimir Prelog at ETH Zurich in Switzerland. [12] He worked for nearly a year on alkaloid chemistry in an unpaid position. [9] [16]

During a brief period in 1949, he was unable to find a job in his original home area in the Punjab. [9] He returned to England on a fellowship to work with George Wallace Kenner and Alexander R. Todd on peptides and nucleotides. [16] He stayed in Cambridge from 1950 until 1952.

He moved to Vancouver, British Columbia, with his family in 1952 after accepting a position with the British Columbia Research Council at University of British Columbia. [12] [17] Khorana was excited by the prospect of starting his own lab, a colleague later recalled. [9] His mentor later said that the Council had few facilities at the time but gave the researcher "all the freedom in the world". [18] His work in British Columbia was on "nucleic acids and synthesis of many important biomolecules" according to the American Chemical Society. [14]

In 1960 Khorana accepted a position as co-director of the Institute for Enzyme research at the Institute for Enzyme Research at the University of Wisconsin at Madison. [14] [19] He became a professor of biochemistry in 1962 and was named Conrad A. Elvehjem Professor of Life Sciences at Wisconsin–Madison. [20] While at Wisconsin, "he helped decipher the mechanisms by which RNA codes for the synthesis of proteins" and "began to work on synthesizing functional genes" according to the American Chemical Society. [14] During his tenure at this University, he completed the work that led to sharing the Nobel prize. The Nobel web site states that it was "for their interpretation of the genetic code and its function in protein synthesis". Har Gobind Khorana's role is stated as follows: he "made important contributions to this field by building different RNA chains with the help of enzymes. Using these enzymes, he was able to produce proteins. The amino acid sequences of these proteins then solved the rest of the puzzle." [21]

He became a US citizen in 1966. [22] Beginning in 1970, Khorana was the Alfred P. Sloan Professor of Biology and Chemistry at the Massachusetts Institute of Technology [23] [12] [24] and later, a member of the Board of Scientific Governors at The Scripps Research Institute. He retired from MIT in 2007. [22]

Har Gobind Khorana married Esther Elizabeth Sibler in 1952. They had met in Switzerland and had three children, Julia Elizabeth, Emily Anne, and Dave Roy.

Ribonucleic acid (RNA) with two repeating units (UCUCUCU → UCU CUC UCU) produced two alternating amino acids. This, combined with the Nirenberg and Leder experiment, showed that UCU genetically codes for serine and CUC codes for leucine. RNAs with three repeating units (UACUACUA → UAC UAC UAC, or ACU ACU ACU, or CUA CUA CUA) produced three different strings of amino acids. RNAs with four repeating units including UAG, UAA, or UGA, produced only dipeptides and tripeptides thus revealing that UAG, UAA, and UGA are stop codons. [25]

Their Nobel lecture was delivered on 12 December 1968. [25] Khorana was the first scientist to chemically synthesize oligonucleotides. [26] This achievement, in the 1970s, was also the world's first synthetic gene in later years, the process has become widespread. [23] Subsequent scientists referred to his research while advancing genome editing with the CRISPR/Cas9 system. [22]

Subsequent research

He extended the above to long DNA polymers using non-aqueous chemistry and assembled these into the first synthetic gene, using polymerase and ligase enzymes that link pieces of DNA together, [26] as well as methods that anticipated the invention of polymerase chain reaction (PCR). [27] These custom-designed pieces of artificial genes are widely used in biology labs for sequencing, cloning and engineering new plants and animals, and are integral to the expanding use of DNA analysis to understand gene-based human disease as well as human evolution. Khorana's invention(s) have become automated and commercialized so that anyone now can order a synthetic oligonucleotide or a gene from any of a number of companies. One merely needs to send the genetic sequence to one of the companies to receive an oligonucleotide with the desired sequence.

After the middle of the 1970s, his lab studied the biochemistry of bacteriorhodopsin, a membrane protein that converts light energy into chemical energy by creating a proton gradient. [28] Later, his lab went on to study the structurally related visual pigment known as rhodopsin. [29]

A summary of his work was provided by a former colleague at the University of Wisconsin: "Khorana was an early practitioner, and perhaps a founding father, of the field of chemical biology. He brought the power of chemical synthesis to bear on deciphering the genetic code, relying on different combinations of trinucleotides." [14] [4]

In addition to sharing the Nobel prize (while he was working at the University of Wisconsin–Madison in the U.S.), [13] Khorana was elected as Foreign Member of the Royal Society (ForMemRS) in 1978. [30] In 2007, the University of Wisconsin–Madison, the Government of India (DBT Department of Biotechnology), and the Indo-US Science and Technology Forum jointly created the Khorana Program. The mission of the Khorana Program is to build a seamless community of scientists, industrialists, and social entrepreneurs in the United States and India.

The program is focused on three objectives: [31] Providing graduate and undergraduate students with a transformative research experience, engaging partners in rural development and food security, and facilitating public-private partnerships between the U.S. and India. The Wisconsin–India Science and Technology Exchange Program (WINStep Forward, WSF) adopted administration responsibilities for the Khorana program in 2007. [32] WINStep Forward was jointly created by Drs. Aseem Ansari and Ken Shapiro at the University of Wisconsin–Madison. WINStep Forward also administers the nationally competitive S.N. Bose Programs for Indian and American students, respectively, to promote both fundamental and applied research not only in biotechnology but broadly across all STEM (science, technology, engineering, and mathematics) fields, including medicine, pharmacy, agriculture, wildlife and climate change.

In 2009, Khorana was hosted by the Khorana Program and honored at the 33rd Steenbock Symposium in Madison, Wisconsin. [19]

Other honors included the Louisa Gross Horwitz Prize from Columbia University and the Lasker Foundation Award for Basic Medical Research, both in 1969, the Golden Plate Award of the American Academy of Achievement in 1971, [33] the Willard Gibbs Medal of the Chicago section of the American Chemical Society, in 1974, the Gairdner Foundation Annual Award, in 1980 and the Paul Kayser International Award of Merit in Retina Research, in 1987. [12]

On 9 January 2018, a Google Doodle celebrated the achievements [34] of Har Gobind Khorana on what would have been his 96th birthday. [35] [36]

Khorana died on 9 November 2011, in Concord, Massachusetts, at the age of 89. His wife, Esther, and daughter, Emily Anne, had died earlier, [14] but Khorana was survived by his other two children. [10] Julia Elizabeth later wrote about her father's work as a professor: "Even while doing all this research, he was always really interested in education, in students and young people." [12]