Informations

ARN polymérase et ADN hélicase

ARN polymérase et ADN hélicase



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

L'ADN hélicase ou l'ARN polymérase sont-elles responsables de la rupture de la liaison hydrogène entre les 2 brins lors de la transcription pour les cellules eucaryotes ? Mon manuel (WJEC Biology for AS level) dit que c'est l'ADN hélicase qui rompt les liaisons hydrogène tandis que l'ARN polymérase catalyse la formation de liaisons entre les nucléotides d'ARN.

L'enzyme ADN hélicase rompt les liaisons hydrogène entre les bases dans une région spécifique de la molécule d'ADN. Cela provoque la séparation et le déroulement des deux brins, exposant les bases nucléotidiques. L'enzyme ARN polymérase se lie au brin matrice d'ADN au début de la séquence à copier.

Cependant, lorsque j'ai recherché en ligne, par exemple sur https://en.wikiversity.org/wiki/Effect_of_hydrogen_bond_on_RNA

La transcription peut être expliquée facilement en 4 ou 5 étapes simples, chacune se déplaçant comme une vague le long de l'ADN. L'ARN polymérase déroule/« décompresse » l'ADN en brisant les liaisons hydrogène entre les nucléotides complémentaires. Les nucléotides d'ARN sont appariés avec des bases d'ADN complémentaires. Le squelette ARN sucre-phosphate se forme avec l'aide de l'ARN polymérase.

L'ARN polymérase rompt-elle alors les liaisons hydrogène ? Si l'ARN polymérase peut rompre les liaisons hydrogène entre les brins, quel est le rôle de l'ADN hélicase dans le processus de transcription ?


Clause de non-responsabilité

Comme je l'ai souligné dans mon commentaire, il n'est pas clair si les sources mentionnées concernent des eucaryotes ou des procaryotes, en supposant qu'elles soient correctes. Je suis un homme de traduction, plutôt qu'un homme de transcription, et je réponds donc à cette question à partir de l'édition 2002 de Berg et al. 'Biochimie', car il se trouve que j'ai un exemplaire du mien (un cadeau de l'époque où j'enseignais encore) et cette édition est disponible gratuitement en ligne. Les membres de la liste ayant plus d'expertise dans ce domaine sont encouragés à publier des commentaires pour corriger toute erreur dans ma réponse ou fournir des mises à jour.

Réponse

  1. dans ni procaryotes ni eucaryotes est l'ADN hélicase qui opère lors de la réplication de l'ADN impliquée dans la transcription bien que d'autres protéines nécessaires à la transcription aient une activité ADN hélicase.

  2. Dans procaryotes il semble que l'holoenzyme ARN polymérase (constituée de seulement quatre sous-unités) soit responsable du déroulement d'environ 17 paires de bases d'ADN matrice. Citant la section 28.1.3 :

    Chaque molécule de polymérase liée déroule un segment d'ADN de 17 pb, ce qui correspond à 1,6 tour d'hélice d'ADN-B

    Il peut y avoir une certaine ambiguïté causée par la description de la façon dont cette valeur a été déterminée expérimentalement car elle impliquait l'ajout de topoisomérase II. Cependant, il ressort clairement de la discussion ailleurs qu'il s'agit d'une enzyme de réplication de l'ADN et qu'elle n'est pas impliquée dans la transcription.

  3. Dans eucaryotes la transcription est beaucoup plus complexe, impliquant des polymérases séparées pour différentes classes de produits d'ARN et une variété de facteurs de transcription auxiliaires dans le cas de l'ARN polymérase II, qui transcrit l'ARNm. Selon l'article 28.2.4 :

    La boîte TATA de l'ADN se lie à la surface concave de la TBP [la protéine de liaison à la boîte TATA]. Cette liaison induit de grands changements de conformation dans l'ADN lié. La double hélice est sensiblement déroulée pour élargir son petit sillon, lui permettant d'établir un contact étendu avec les brins β antiparallèles du côté concave du TBP.

    Ainsi, la reconnaissance initiale de la boîte TATA provoque un certain dénouement. Cependant, l'acteur principal semble être le facteur de transcription TFIIF :

    une hélicase dépendante de l'ATP qui sépare initialement le duplex d'ADN pour la polymérase


ARN polymérase ou ADN hélicase. Et l'expression des gènes.

Ainsi, lors de la transcription dans le noyau, le brin d'ADN est «décompressé» afin que la séquence de bases complémentaires puisse être copiée et l'ARNm extrait du noyau et sur un ribosome. Est-ce l'ADN hélicase qui rompt les liaisons hydrogène au sein de l'ADN ou est-ce l'ARN polymérase ? Je pensais que c'était l'ADN hélicase qui brisait les liaisons hydrogène/ou décompressait, et l'ARN polymérase qui réunissait tous les composants pour former le brin d'ARNm. Est-ce bien, et s'il vous plaît corriger tout ce que je me suis trompé.

AUSSI, quelle est la différence entre le gène opérateur et la région promotrice ? Est-ce que : la molécule répresseur s'attache au gène opérateur pour empêcher la liaison de l'ARN polymérase, mais si la molécule répresseur est absente, la région promotrice est l'endroit où l'ARN polymérase se liera ? Encore une fois s'il vous plaît corriger tout ce qui ne va pas, cela me confond un peu

Merci

Pas ce que vous cherchez ? Essayer&bonjour

(Message original de j'aime le fruit)
Ainsi, lors de la transcription dans le noyau, le brin d'ADN est «décompressé» afin que la séquence de bases complémentaires puisse être copiée et l'ARNm extrait du noyau et placé sur un ribosome. Est-ce l'ADN hélicase qui rompt les liaisons hydrogène au sein de l'ADN ou est-ce l'ARN polymérase ? Je pensais que c'était l'ADN hélicase qui brisait les liaisons hydrogène/ou décompressait, et l'ARN polymérase qui réunissait tous les composants pour former le brin d'ARNm. Est-ce bien, et s'il vous plaît corriger tout ce que je me suis trompé.

AUSSI, quelle est la différence entre le gène opérateur et la région promotrice ? Est-ce que : la molécule répresseur s'attache au gène opérateur pour empêcher la liaison de l'ARN polymérase, mais si la molécule répresseur est absente, la région promotrice est l'endroit où l'ARN polymérase se liera ? Encore une fois s'il vous plaît corriger tout ce qui ne va pas, cela me confond un peu

Merci


Expression génique : transcription du code génétique

Transcription dirigée par l'ARN polymérase I et III

Les ARN polymérases eucaryotes I et III reposent sur un ensemble distinct de protéines pour initier la transcription. Bien que les ARN polymérases I et III partagent plusieurs sous-unités enzymatiques centrales identiques avec l'ARN polymérase II, elles reconnaissent des séquences de promoteurs très différentes et possèdent des facteurs de transcription généraux uniques. Les promoteurs reconnus par l'ARN polymérase I ne sont pas bien conservés en séquence d'une espèce à l'autre. Cependant, ils ont tous une architecture générale similaire du promoteur car il se compose d'un élément central entourant le site de démarrage de la transcription et d'un élément promoteur en amont, qui est environ 100 pb plus en amont. L'ARN polymérase I, qui transcrit les gènes de l'ARNr, se lie au promoteur contenant un élément promoteur central et un élément de contrôle en amont (UCE). Le TBP, qui fait partie d'un complexe plus vaste appelé SL1, aide l'ARN polymérase I à reconnaître le promoteur central (Fig. 3.22). Les promoteurs classiques de l'ARN polymérase III sont de type I et de type II qui ont des promoteurs qui se trouvent entièrement dans les gènes. Ces gènes de type I et de type II comprennent une variété de gènes d'ARN tels que l'ARNt, la sous-unité d'ARN 5S du ribosome et les gènes d'ARN VA d'adénovirus (figure 3.23). Les promoteurs de l'ARN polymérase III de type III ne sont pas classiques et ressemblent à ceux des gènes de classe II, notamment le gène snRNA U6, le gène ARN 7SL et le gène ARN 7SK.

Figure 3.22. Les promoteurs d'ARN pol I contiennent une région centrale ainsi qu'un élément de contrôle en amont (UCE), qui interagissent avec des facteurs de transcription comme UBF et SL1 chez l'homme.

3.23 . Exemples de promoteurs d'ARN polymérase III. Les cases rouges signifient les promoteurs des gènes de l'ARNr 5S, de l'ARNt et de l'ARNsn U6. DSE représente un élément de séquence distal, PSE représente un élément de séquence proximal.


Les cellules de mammifères peuvent reconvertir des segments d'ARN en ADN, révèle une nouvelle recherche

Une équipe de chercheurs de l'Université Thomas Jefferson de Philadelphie, de l'Université de Californie du Sud, du Beckman Research Institute of the City of Hope et de la New York University School of Medicine a fourni la première preuve que les séquences d'ARN peuvent être réécrites dans l'ADN, un exploit plus fréquent chez les virus que les cellules eucaryotes.

Structure ternaire de Polθ sur un modèle d'amorce ADN/ARN : (A) Polymérase Polθ (B) Extension ADN/ARN par Polθ et PolθΔL (C) structure de Polθ:DNA/ARN:ddGTP (D) Superposition de Polθ:DNA/ ARN (marine) et Polθ:DNA/DNA (orange, 4x0q) les sous-domaines des doigts et du pouce subissent une reconfiguration (E) superposition de Polθ:DNA/RNA (marine) et Polθ:DNA/DNA (orange, 4x0q) mettant en évidence un 12- Å décalage de K2181 (pouce de la boîte bleue) et un décalage de 4,4-Å de E2246 (paume de la boîte grise) (F) superposition d'acides nucléiques et ddGTP de Polθ:DNA/RNA:ddGTP et Polθ:DNA/DNA:ddGTP structures (G ) en haut : densité électronique du ddGTP et de l'extrémité 3' de l'amorce dans la structure Polθ : ADN/ARN en bas : image agrandie de la superposition des sites actifs, illustrant une conformation différente du ddGTP dans les Polθ : ADN/ARN (bleu) et Polθ :complexes ADN/ADN (saumon) (H) interactions entre les groupes ribose 2'-hydroxyle de la matrice d'ARN et les résidus dans la structure Polθ:ADN/ARN lignes pointillées rouges, liaisons hydrogène (I) ADN/ARN utilisé pour la cocristallisation avec Polθ et ddGTP (en haut) une forte densité électronique est présente pour quatre paires de bases [nucléotides situés aux positions 2 à 5 (souligné) de l'ADN/ARN] et deux paires de bases résultant d'un ddGMP incorporé (2',3' didésoxyguanosine monophosphate ) (position verte 1) et un ddGTP non incorporé lié (position rouge 0) dans les interactions du site actif (en haut) entre Polθ et les acides nucléiques dans les interactions Polθ:ADN/ARN:ddGTP (en bas) entre les résidus et le squelette phosphate, sucre oxygène, ou la nucléobase sont indiquées en bleu, jaune et vert, respectivement les liaisons hydrogène entre Polθ et les groupes ribose 2'-hydroxyle sont indiquées (résidus encadrés) (J) interactions entre Polθ et les acides nucléiques dans Polθ:ADN/ADN:ddGTP (4x0q) schéma de couleurs identique à (I). Crédit image : Chandramouly et al., doi: 10.1126/sciadv.abf1771.

« La réalité selon laquelle une polymérase humaine peut le faire avec une grande efficacité soulève de nombreuses questions. »

"Par exemple, cette découverte suggère que les messages d'ARN peuvent être utilisés comme modèles pour réparer ou réécrire l'ADN génomique."

Dans leur étude, le Dr Pomerantz et ses collègues se sont concentrés sur une polymérase très inhabituelle appelée polymérase thêta (Polθ).

Sur les 14 ADN polymérases présentes dans les cellules de mammifères, seules trois effectuent l'essentiel du travail de duplication de l'ensemble du génome pour préparer la division cellulaire.

Les 11 autres sont principalement impliqués dans la détection et la réparation en cas de rupture ou d'erreur dans les brins d'ADN.

Polθ répare l'ADN, mais est très sujet aux erreurs et fait de nombreuses erreurs ou mutations.

Les scientifiques ont remarqué que certaines des qualités de Polθ étaient celles qu'il partageait avec une autre machine cellulaire, bien qu'une plus courante dans les virus - la transcriptase inverse.

Comme Polθ, la transcriptase inverse du VIH agit comme une ADN polymérase, mais peut également se lier à l'ARN et relire l'ARN dans un brin d'ADN.

Dans une série d'expériences, les auteurs ont testé Polθ contre la transcriptase inverse du VIH, qui est l'une des mieux étudiées en son genre.

Ils ont montré que Polθ était capable de convertir les messages d'ARN en ADN, ce qu'il a fait aussi bien que la transcriptase inverse du VIH, et qu'il a en fait fait un meilleur travail que lors de la duplication d'ADN en ADN.

Polθ était plus efficace et introduisait moins d'erreurs lors de l'utilisation d'une matrice d'ARN pour écrire de nouveaux messages d'ADN que lors de la duplication d'ADN en ADN, ce qui suggère que cette fonction pourrait être son objectif principal dans la cellule.

En utilisant la cristallographie aux rayons X, l'équipe a découvert que cette molécule était capable de changer de forme afin de s'adapter à la molécule d'ARN plus volumineuse - un exploit unique parmi les polymérases.

"Nos recherches suggèrent que la fonction principale de Polθ est d'agir comme une transcriptase inverse", a déclaré le Dr Pomerantz.

"Dans les cellules saines, le but de cette molécule peut être la réparation de l'ADN par l'ARN."

"Dans les cellules malsaines, telles que les cellules cancéreuses, Polθ est fortement exprimé et favorise la croissance des cellules cancéreuses et la résistance aux médicaments."

"Ce sera passionnant de mieux comprendre comment l'activité de Polθ sur l'ARN contribue à la réparation de l'ADN et à la prolifération des cellules cancéreuses."


MATÉRIAUX ET MÉTHODES

Essais d'extension d'amorce-matrice

Vitesse relative de l'activité RT (Fig. 1B). Polθ (0,5 nM), HIV RT et Polη (noyau catalytique, résidus 1 à 514) ont été incubés avec 10 nM de matrice d'ADN/ARN radiomarqué (RP559/RP493R) pendant les durées indiquées dans du tampon A [25 mM de tris-HCl (pH 7.8), 10 mM de MgCl2, 0,01 % (v/v) de NP-40, 1 mM de dithiothréitol (DTT), d'albumine de sérum bovin (BSA 0,1 mg/ml) et 10 % (v/v) de glycérol] avec 100 M de dNTP à 37°C. Le pourcentage d'extension a été déterminé en divisant l'intensité du produit étendu par l'intensité de la somme des produits étendus et non étendus pour chaque voie. Toutes les réactions amorce-matrice ont été terminées avec 25 mM d'EDTA et 45 % (v/v) de formamide, puis résolues dans des gels de polyacrylamide dénaturant l'urée et visualisées par PhosphorImager. Le taux d'activité RT a été déterminé à partir de la pente de la partie linéaire du graphique représentant les conditions d'équilibre.

Comparaison des activités polymérases sur ADN/ADN et ADN/ARN (Fig. 1, D à G). Les tests d'extension d'amorce sur des matrices ADN/ARN (RP559/RP493R) et ADN/ADN (RP559/RP493D) ont été effectués en utilisant les conditions de la figure 1B avec les modifications suivantes. Les concentrations indiquées des polymérases indiquées ont été utilisées et les réactions ont été effectuées pendant 32 min.

Activité RT relative (Fig. 1H). Les polymérases indiquées ont été incubées avec 10 nM de matrice ADN/ARN radiomarquée (SM98/SM44R) pendant 20 min en présence de 10 M de dNTP à 37°C. Les réactions Polθ et HIV RT ont été réalisées dans 25 mM de tris-HCl (pH 8,0), 10 mM de KCl, 10 mM de MgCl2, 0,01 % (v/v) de NP-40, 1 mM de DTT, BSA (0,1 mg/ml) et 10 % (v/v) de glycérol. Les réactions contenant de l'AMV RT (20 unités, New England Biolabs) ont été réalisées dans un tampon [50 mM de tris-acétate (pH 8,3), 75 mM d'acétate de potassium, 8 mM d'acétate de magnésium et 10 mM de DTT] et contenaient de la BSA (0,1 mg/ ml). Les réactions contenant du M-MuLV RT (400 unités, New England Biolabs) ont été réalisées dans un tampon [50 mM de tris-HCl (pH 8,3), 75 mM de KCl, 3 mM de MgCl2et 10 mM de DTT] et contenait du BSA (0,01 mg/ml).

Comparaison des activités de synthèse d'ADN RT et dépendantes de l'ADN par Polθ tronqué et pleine longueur (Fig. 1J). Cent nanomolaires des polymérases indiquées ont été incubées avec 10 nM d'ADN/ARN radiomarqué (SM98/SM44R) ou d'ADN/ADN (SM98/SM44) pendant 45 min avec 50 M de dNTP et 25 mM de tris-HCl (pH 7,8), 2 mM MgCl2, 4 mM de KCl, 6 mM de NaCl, 0,01 % (v/v) de NP-40, 1 mM de DTT, BSA (0,1 mg/ml), 10 % (v/v) de glycérol et 750 M d'adénosine triphosphate (ATP) à 37°C.

Vitesse relative de l'incorporation de dNMP unique sur l'ADN/ARN radiomarqué (Fig. 2, A à E). Polθ (2 nM) a été incubé avec 100 nM des matrices d'ADN/ARN et d'ADN/ADN radiomarqués indiqués pendant les durées indiquées avec 300 M de dNTP indiqué dans un tampon [25 mM de tris-HCl (pH 8,0), 10 mM de MgCl2, 4 mM de KCl, 6 mM de NaCl, 0,01 % de NP-40, 1 mM de DTT, BSA (0,01 mg/ml) et 10 % (v/v) de glycérol] à 37°C. Le pourcentage d'extension a été déterminé comme décrit ci-dessus.

Vitesse relative de la mésincorporation des nucléotides (dNMP) (Fig. 2, F à J). Polθ (20 nM) a été incubé avec 100 nM des matrices ADN/ARN et ADN/ADN radiomarquées indiquées et 300 M du dNTP indiqué pendant les durées indiquées dans du tampon [25 mM de tris-HCl (pH 8,0), 10 mM de MgCl2, 10 mM de KCl, 0,01 % (v/v) de NP-40, 1 mM de DTT, BSA (0,1 mg/ml) et 10 % (v/v) de glycérol]. Le pourcentage d'extension a été déterminé comme décrit ci-dessus. Tous les oligonucléotides ont été radiomarqués en utilisant la polynucléotide kinase T4 (New England Biolabs) et du 32 P-γ-ATP (PerkinElmer) dans un tampon recommandé à 37°C pendant au moins 1 heure.

Dosage cellulaire MMEJ

Certaines des méthodes utilisées ici sont similaires à celles d'un article publié précédemment (38). Les iPSCs (2 × 10 5 ) ont été transfectées en suspension avec 0,25 ug de chacune des constructions GFP d'ADN flanquées à gauche et à droite en utilisant la Lipofectamine 2000 (Invitrogen). En tant que contrôle négatif, un volume similaire de tampon qui a été utilisé dans les puits expérimentaux a été utilisé pour la transfection dans les puits de contrôle. En tant que contrôle positif pour mesurer l'efficacité de la transfection, une construction d'expression d'ADN GFP linéaire de type sauvage a été transfectée simultanément. Les fréquences cellulaires positives pour la GFP ont été mesurées 3 jours après la transfection par cytométrie en flux en utilisant GUAVA easyCyte 5-HT (Luminex Corp.) dans des réplicats indépendants et corrigées pour l'efficacité de la transfection et les événements de fond. Les données sont représentées par la moyenne et le SEM de trois expériences indépendantes, avec au moins des doublons par expérience. L'analyse statistique a été réalisée par paires t test.

Préparation des constructions de rapporteurs GFP MMEJ

Certaines des méthodes utilisées ici sont similaires à celles d'un article publié précédemment (38). La préparation de la réaction en chaîne par polymérase (PCR) a suivi les conditions recommandées pour l'ADN polymérase Phusion High-Fidelity (New England Biolabs M0530) en utilisant 10 ng de plasmide pCMV-GFP comme matrice dans 1 × Phusion HF Buffer. La PCR de l'ADN du flanc gauche a été réalisée avec les amorces RP500B et RP501. La PCR pour l'ADN du flanc droit a été réalisée avec les amorces RP502 et RP503B. Après la PCR, les produits d'ADN du flanc gauche ou droit ont été regroupés et digérés avec Dpn I (New England Biolabs) dans un tampon CutSmart 1 ×, puis purifiés via le kit de purification Qiagen QIAquick PCR. La PCR a ensuite été conjuguée à la streptavidine en utilisant la PCR (110 ng/μl) et la streptavidine (0,8 g/μl) dans 10 mM de tris-HCl (pH 7,5) et 100 mM de NaCl à 37°C pendant 1 heure. La PCR de l'ADN du flanc gauche avec cinq ribonucléotides consécutifs a été réalisée avec les amorces RP500B et RP501. La PCR a été purifiée puis digérée avec Dpn I (New England Biolabs) et Sap I dans un tampon CutSmart 1x. La PCR a été purifiée à nouveau puis ligaturée à un ADN double brin composé d'oligonucléotides annelés RP550R-P et RP530a [les oligos ont été annelés en présence d'un inhibiteur de la ribonucléase (RNase)] pendant 16 heures à 16°C avec de l'ADN ligase T4 (Nouvelle Angleterre Biolabs) dans 1 × tampon ADN ligase T4. La PCR ligaturée a été purifiée puis conjuguée à la streptavidine comme décrit ci-dessus. La PCR pour l'ADN du flanc gauche avec 10 ribonucléotides consécutifs a été préparée par la même méthodologie avec ligature à l'ADN double brin composé des oligos RP546P et RP530. Les étapes de conjugaison de streptavidine et d'amplification d'ADN ont été confirmées dans des gels d'agarose colorés au bromure d'éthidium.

Test de rapporteur GFP knock-in CRISPR-Cas9

L'U2OS parental et POLQ e16m des lignées cellulaires avec les plasmides ∆7-reporter et CAS9/single guide RNA (sgRNA) pour cibler les DSB dans ce rapporteur, la matrice oligonucléotidique d'ADN et l'oligonucléotide de contrôle (LUC) ont été précédemment décrits (36). L'oligonucléotide R2 a la même séquence que les oligonucléotides d'ADN, mais avec deux bases d'ARN dans les 7 nt manquantes du ∆7-reporter (IDT). Les lignées cellulaires ont été ensemencées à 1 × 10 5 sur une boîte de 12 puits et transfectées le lendemain, et le % GFP a été analysé 3 jours après la transfection à l'aide d'un cytomètre CyAN-ADP (DAKO) et normalisé à l'efficacité de transfection, comme décrit précédemment (36). Les transfections pour le dosage du rapporteur contenaient 400 ng de chaque plasmide CAS9/sgRNA, 10 pmol d'oligonucléotide et 100 ng de pCAGGS-BSKX (vecteur vide) ou de vecteur d'expression FLAG-POLQ (38). Les transfections pour l'efficacité de la transfection contenaient 400 ng de pCAGGS-NZE-GFP (vecteur d'expression GFP), 500 ng de vecteur vide (EV) et 10 pmol d'oligonucléotide de contrôle (36). Les transfections ont été réalisées avec 4 µl de Lipofectamine 2000 (Thermo Fisher Scientific) dans 0,2 ml d'Optimem (Thermo Fisher Scientific) et incubées avec les cellules dans 1 ml de milieu sans antibiotique pendant 4 heures. L'analyse d'immunotransfert pour FLAG-POLQ impliquait une extraction avec ELB [250 mM NaCl, 5 mM EDTA, 50 mM Hepes, 0,1% (v/v) Ipegal et Roche protéase inhibiteur] avec sonication (Qsonica, Q800R) et en utilisant des anticorps pour FLAG ( Sigma-Aldrich, A8592) ou ACTIN (Sigma-Aldrich, A2066). Analyse de séquence du test rapporteur avec oligo R2 : les cellules ont été transfectées comme pour le test rapporteur avec la matrice oligonucléotidique R2 dans le POLQ e16m cellules avec le vecteur d'expression POLQ, les cellules GFP+ ont été isolées par tri cellulaire activé par fluorescence (FACS) (Becton Dickinson Aria Sorter), et le produit de réparation GFP a été amplifié avec CMVFWDFRT5 5′ CGCAAATGGGCGGTAGGCGTG et BGHREVFRT5 5′ TAGAAGGCACAGTCGAGG et séquencé avec le CMVFWRT5 apprêt.

Synthèse d'ADNc

Les réactions de synthèse d'ADNc ont été réalisées par la polymérase indiquée en présence de 100 M de dNTP et d'un tampon optimal pour chaque enzyme : Polθ [25 mM tris-HCl (pH 8,0), 10 mM KCl, 10 mM MgCl2, 0,01 % (v/v) de NP-40, 1 mM de DTT, BSA (0,1 mg/ml) et 10 % (v/v) de glycérol] AMV RT [50 mM de tris-acétate (pH 8,3), 75 mM de potassium acétate, 8 mM d'acétate de magnésium, 10 mM de DTT et BSA (0,1 mg/ml)] et M-MuLV RT [50 mM de tris-HCl (pH 8,3), 75 mM de KCl, 3 mM de MgCl2, et 10 mM DTT]. Les réactions avec l'ADN/ARN synthétique contenaient 10 ng de matrice. Polθ (100 nM), AMV-RT (20 unités) ou M-MuLV RT (400 unités) ont été incubés à 37°C (Polθ) ou 42°C (AMV-RT et M-MuLV RT) pendant 1 heure. Les enzymes ont ensuite été inactivées à chaud à 85 °C pendant 20 min. L'ADNc (0,1875 ng) a été utilisé pour la PCR en temps réel (Power SYBR Green Master Mix, Thermo Fisher Scientific) en utilisant les amorces SM246 et SM247.

Protéines

Polθ, Fl-Polθ et Polδ ont été purifiés comme décrit précédemment (1, 9). Les pôles β et ont été fournis par S. Wilson. Polκ a été acheté chez Enzymax LLC. HIV RT RT52A optimisé pour la cristallographie aux rayons X a été fourni par le Dr E. Arnold. Polη a été fourni par le Dr S. Arora. Les pôles ε et α ont été fournis par le Dr M. O'Donnell. Polγ Exo- a été fourni par le Dr W. Copeland. M-MuLV, AMV RT et KF Pol ont été achetés auprès de New England Biolabs.

Purification des protéines pour la cristallographie aux rayons X

Le gène codant pour Polθ (résidus 1819 à 2590) a été optimisé pour les codons et cloné dans le vecteur pSUMO pour générer une fusion sumo qui porte une étiquette N-terminale 6 × His et un site de clivage de protéase PreScission. Polθ-exprimant E. coli Les cellules Rosetta(DE3)pLysS ont été cultivées à 37°C dans du milieu LB jusqu'à densité optique à 600 nm (DO600) atteint 0,3, la température de croissance est ensuite abaissée à 16°C, et E. coli les cellules ont été davantage cultivées. L'expression de la protéine a été induite par l'ajout de 0,1 mM d'isopropyl β-d-thiogalactopyranoside lorsque la DO600 atteint 0,7 à 0,9. E. coli les cellules ont été cultivées à 16°C pendant une nuit et récoltées par centrifugation. Le culot cellulaire a été remis en suspension dans du tampon L [50 mM Hepes (pH 8,0), 500 mM NaCl, 0,005% (v/v) Igepal CA 630 et 0,5 mM TCEP] lysé par sonication ou French Press en présence de DNase I (20 g/ml), RNase A (30 g/ml), 5 mM MgCl2, 2 mM de CaCl2, et 1 mM de fluorure de phénylméthylsulfonyle puis centrifugé à 12 000g pendant 45 minutes. La fusion 6 × His sumo a été capturée par chromatographie gravitaire sur agarose Ni-NTA suivie d'une série de lavages par tampon W [50 mM Hepes (pH 8,0), 500 mM NaCl, 0,005% (v/v) Igepal CA 630, 0,5 mM de TCEP et 10 mM d'imidazole]. Cinq millilitres de tampon L et de protéase de précision ont été ajoutés pour cliver Polθ du marqueur 6xHis en passant une nuit à 4°C. La Polθ clivée a été éluée encore deux fois par 5 ml de tampon L. La protéine éluée a été purifiée jusqu'à homogénéité en utilisant une colonne HiTrap Heparin (GE Healthcare Life Sciences). La protéine a été concentrée à 5 mg/ml dans un tampon d'acétate d'ammonium (150 mM), de KCl (150 mM), de tampon tris-HCl (pH 8,0) (40 mM), de TCEP (2,5 mM) et de glycérol (1% v/v).

Cristallisation et détermination de la structure

La condition de cristallisation a été identifiée par criblage à large matrice. Les plaques de criblage par cristallisation en gouttes assises ont été réglées à 18°C ​​en utilisant le robot ARI Crystal Gryphon (ARI) et des solutions de criblage par cristallisation (Qiagen et Hampton Research). Réaction de Polθ (2,5 mg/ml) avec un hybride ADN/ARN (amorce ADN : 5′-GCGGCTGTCATT et matrice ARN : 5′-CGUCCAUGACAGCCGC) en présence de ddGTP (1 mM), saccharose monolaurate (300 μM), MgCl2 (1 mM) et le tétrachlorhydrate de spermine (20 mM) ont préparé l'échantillon pour la diffusion de vapeur en gouttes assises sur un réservoir de 50 l contenant 20% (w/v) d'éthanol en mélangeant 0,3 l de la solution du réservoir avec une partie égale de la réaction Solution. Des cristaux de dimensions finales approximatives de 20 um sur 20 um sur 20 um se sont développés au cours des 2 semaines suivantes. La cryoprotection a été obtenue en bouclant les cristaux dans une solution mère avec 25 % supplémentaires (v/v) de glycérol avant un refroidissement éclair dans de l'azote liquide. Les données de diffraction ont été collectées sur la ligne de lumière 23ID-D de l'Institut national des sciences médicales générales et de l'installation de biologie structurelle de l'Institut national du cancer à la source avancée de photons. Un ensemble de données complet pour Polθ a été collecté, indexé, intégré et mis à l'échelle par le package d'autotraitement dans le serveur APS (GMCAproc). Le programme Phaser-MR du package PHENIX a été utilisé pour le remplacement moléculaire, et COOT a été utilisé pour la reconstruction du modèle et Phenix pour le recuit et le raffinement simulés. La structure de Polθ a été déterminée par remplacement moléculaire (MR) en utilisant Polθ [Protein Data Bank (PDB): 4x0q] comme modèle de recherche. La structure PDB complète de 4x0q n'a pas pu apporter de solution. Une solution MR n'a été obtenue qu'en supprimant certaines des boucles et en supprimant le duplex ADN/ADN du modèle. Les phases initiales du modèle de protéine MR ont été améliorées par la construction et le raffinement du modèle cyclique, ce qui nous permet de construire lentement les boucles manquantes, les domaines des doigts et du pouce repliés et réorientés, et les résidus d'ADN/ARN sur la base de cartes de densité électronique améliorées. . Un modèle final avec de très bonnes statistiques pour cette plage de résolution de 3,2 a été réalisé (tableau S1).

Acides nucléiques

Les acides nucléiques suivants ont été achetés auprès d'Integrated DNA Technologies (répertoriés comme polarité 5'-3') :


Possibilités d'accès

Obtenez un accès complet au journal pendant 1 an

Tous les prix sont des prix NET.
La TVA sera ajoutée plus tard dans la caisse.
Le calcul des taxes sera finalisé lors du paiement.

Obtenez un accès limité ou complet aux articles sur ReadCube.

Tous les prix sont des prix NET.


Fonction ARN polymérase

L'ARN polymérase est l'enzyme la plus importante dans le processus de transcription. N'oubliez pas que la transcription est le processus de copie de l'ADN double brin en un seul brin d'ARN. Ils peuvent sembler légèrement différents, mais ils sont tous deux écrits dans la langue de nucléotides. Pour que l'ARN polymérase puisse commencer son travail, elle doit d'abord trouver un région du promoteur. Cette région peut être ciblée par facteurs de transcription chez les eucaryotes. Ces protéines se lient au site, créant un arrangement approprié pour que l'ARN polymérase se lie et démarre la transcription. Chez les bactéries, il n'y a qu'un seul promoteur, le facteur d'initiation sigma. Ce processus peut être observé avec la molécule de polymérisation d'ARN généralisée illustrée ci-dessous, transcrivant l'ADN. Les facteurs de transcription ne sont pas représentés.

Lorsque l'ARN polymérase se lie à l'ADN, elle change conformation, ou forme. Cela démarre la réaction en chaîne enzymatique qui fait croître une nouvelle chaîne de nucléotides en une molécule d'ARN basée sur la matrice présentée. Une fois que l'ARN polymérase a créé cette nouvelle molécule, l'ARN doit être traité et libéré de la noyau. Maintenant appelé ARN messager, ou ARNm, il rencontrera un ribosome qui possède les mécanismes appropriés pour le processus de Traduction.

Tout comme la traduction de l'anglais vers l'espagnol, le ribosome doit « lire » la séquence de l'ARN et convertir le message dans la langue de acides aminés. Ces petites molécules forment de longues chaînes, qui se replient en formes complexes pour devenir des protéines biochimiquement actives. Ces protéines, à leur tour, créent et maintiennent des parties de l'ADN, ainsi que répliquent l'ADN. Des parties de l'ADN stockent l'information génétique de la protéine ARN polymérase elle-même, qui est d'abord décodée par une molécule d'ARN polymérase. Cette situation est vraiment la base de la poule et de l'œuf si vous y réfléchissez.


Disponibilité des données

  1. Adams PD
  2. Afonine PV
  3. Bunkóczi G
  4. Chen VB
  5. Davis IW
  6. Échols N
  7. Tête JJ
  8. LW accroché
  9. Kapral GJ
  10. Grosse-Kunstleve RW
  11. McCoy AJ
  12. Moriarty NO
  13. Oeffner R
  14. Lire RJ
  15. Richardson DC
  16. Richardson JS
  17. CT Terwilliger
  18. Zwart PH
  1. Owczarzy R
  2. Tataurov AV
  3. Wu Y
  4. JA Manthey
  5. McQuisten KA
  6. Almabrazi HG
  7. Pedersen KF
  8. Lin Y
  9. Garretson J
  10. McEntaggart NON
  11. Marin CA
  12. Dawson RB
  13. Coup d'oeil en tant que
  1. Schutz P
  2. Karlberg T
  3. van den Berg S
  4. Collins R
  5. Lehtio L
  6. Hogbom M
  7. Holmberg-Schiavone L
  8. Tempel W
  9. Parc HW
  10. Hammarström M
  11. Moche M
  12. Thorsell AG
  13. Schüler H

<p>Cette section fournit toutes les informations utiles sur la protéine, principalement des connaissances biologiques.<p><a href='/help/function_section' target='_top'>Plus. </a></p> Fonction i

L'ARN polymérase dépendante de l'ARN réplique le génome viral composé de 2 segments d'ARN, ARN1 et ARN2.

<p>Informations organisées manuellement pour lesquelles il existe des preuves expérimentales publiées.</p> <p><a href="/manual/evidences#ECO:0000269">Plus. </a></p> Assertion manuelle basée sur l'expérience dans i


Transcription / Synthèse d'ARN

L'ARNm est formé à l'aide des codes de l'ADN.

Explication:

La formation d'ARN à partir de codes écrits sur l'ADN est connue sous le nom de transcription, où la double hélice de l'ADN se décompresse et se déroule.

Ensuite, il y a des ribonucléotides libres qui s'apparient avec les bases complémentaires de l'un des brins d'ADN exposés.

Le sucre et le phosphate des ribonucléotides voisins continuent de se joindre et le squelette sucre phosphate de l'ARN se forme. Cet appariement de ribonucléotides complémentaires le long des bases du brin d'ADN est surveillé par l'ARN polymérase, une enzyme.

()

À la fin de ce processus d'appariement, un nouvel ARN simple brin est formé. L'ARN nouvellement formé peut subir une transformation et sera ensuite utilisé pour la synthèse des protéines, c'est-à-dire la traduction.

La vidéo ci-dessous fournit un résumé de la façon dont les processus de transcription et de traduction se produisent à l'aide du didacticiel Shockwave DNA Workshop de PBS.

Réponse:

Explication:

Il existe de nombreux détails sur les deux que vous pouvez approfondir sur wikipedia, mais la principale différence est :

La réplication de l'ADN fabrique deux nouvelles molécules d'ADN double brin à partir d'une molécule d'ADN double brin originale (réplication semi-conservatrice).

La transcription crée un simple brin d'ARN à partir du double brin d'ADN (utilise un brin de l'ADN comme matrice et crée un seul brin d'ARN).

Réponse:

La transcription est le processus par lequel l'ARNm (ARN messager) est produit.

Explication:

Voici les étapes de la transcription.

L'ADN est décompressé par l'enzyme "Hélicase".

L'ARN polymérase ajoute des nucléotides d'ARN au nouveau brin d'ARN. (Dans l'ARN, la thymine est remplacée par l'uracile.)

L'ARNm est complet lorsqu'il atteint un code d'arrêt sur l'ADN.

L'ARNm quitte alors le noyau et transporte le code vers les sites de synthèse des protéines dans le cytoplasme. (L'ADN ne quitte jamais le noyau.)


Voir la vidéo: The roles of Helicase and DNA polymerase in DNA replication (Août 2022).